Rh3CG001600

Catalyzes the ATP-dependent amination of UTP to CTP with either L-glutamine or ammonia as the source of nitrogen

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
195616 .. 199005
3390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG001600.1

Sequence Viewer

Length: 360 bp
ATGGCTGCGGACTATCTTCTCTCAACCCAGTTGGACCTGGACCTTGGAAACTATGAGCGATTCCTAGAAATCAAGCTGACCCATGATAATAATATTTCTACCGAAATGATTTACCAGGTTATCCCTCACATCACAGATGCTATCCAAGACTGGATTAGGCGTGTAGCATATATACCAGTTGATGGAAAGTCAGGCCTTGCTGAGCACCAGTATTGGTCATTTGGTCTTGGCCTTAATCTTTGGGGCAGCCTTGATTGCTTAAAAGCAGTTTGCTTCAAGAGGGTCTGCTACTGTGCCTATCTATCACATTCAAAGGGCAAAACACTTCCTTTTATTACTGTTGAAGAAGGAACTCGCTAG

Protein Analysis

119

Amino Acids

13.62

Weight (kDa)

5.72

Isoelectric Point (pI)

27.61

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CTP_synth_N PF06418 10 - 56 3.3e-08 CTP synthase N-terminus
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 182
AciI CCGC 1 cut(s) 8
AfiI CCNNNNNNNGG 1 cut(s) 182
AgsI TTSAA 3 cut(s) 277, 312, 344
AjnI CCWGG 2 cut(s) 36, 114
AluBI AGCT 1 cut(s) 76
AluI AGCT 1 cut(s) 76
Alw21I GWGCWC 1 cut(s) 207
AoxI GGCC 2 cut(s) 193, 229
ApeKI GCWGC 2 cut(s) 5, 246
AspS9I GGNCC 2 cut(s) 34, 40
AvaII GGWCC 2 cut(s) 34, 40
Bbv12I GWGCWC 1 cut(s) 207
BbvI GCAGC 1 cut(s) 258
BccI CCATC 1 cut(s) 176
BciT130I CCWGG 2 cut(s) 38, 116
BfaI CTAG 2 cut(s) 65, 358
BisI GCNGC 2 cut(s) 6, 247
BlpI GCTNAGC 1 cut(s) 201
BlsI GCNGC 2 cut(s) 7, 248
Bme1390I CCNGG 2 cut(s) 38, 116
Bme18I GGWCC 2 cut(s) 34, 40
BmgT120I GGNCC 2 cut(s) 34, 40
BmrFI CCNGG 2 cut(s) 38, 116
BmrI ACTGGG 1 cut(s) 22
BmsI GCATC 1 cut(s) 127
BmuI ACTGGG 1 cut(s) 22
Bpu1102I GCTNAGC 1 cut(s) 201
BsaJI CCNNGG 1 cut(s) 43
Bsc4I CCNNNNNNNGG 1 cut(s) 182
Bse1I ACTGG 4 cut(s) 28, 155, 176, 208
BseBI CCWGG 2 cut(s) 38, 116
BseDI CCNNGG 1 cut(s) 43
BseLI CCNNNNNNNGG 1 cut(s) 182
BseMII CTCAG 1 cut(s) 192
BseNI ACTGG 4 cut(s) 28, 155, 176, 208
BseXI GCAGC 1 cut(s) 258
BshFI GGCC 2 cut(s) 195, 231
BsiHKAI GWGCWC 1 cut(s) 207
BslI CCNNNNNNNGG 1 cut(s) 182
BsnI GGCC 2 cut(s) 195, 231
Bsp1286I GDGCHC 1 cut(s) 207
Bsp1720I GCTNAGC 1 cut(s) 201
BspACI CCGC 1 cut(s) 8
BspANI GGCC 2 cut(s) 195, 231
BspCNI CTCAG 1 cut(s) 193
BsrI ACTGG 4 cut(s) 28, 155, 176, 208
BssECI CCNNGG 1 cut(s) 43
BssT1I CCWWGG 1 cut(s) 43
Bst2UI CCWGG 2 cut(s) 38, 116
Bst4CI ACNGT 2 cut(s) 293, 340
BstDEI CTNAG 1 cut(s) 201
BstMWI GCNNNNNNNGC 1 cut(s) 255
BstNI CCWGG 2 cut(s) 38, 116
BstSCI CCNGG 2 cut(s) 36, 114
BstV1I GCAGC 1 cut(s) 258
BsuRI GGCC 2 cut(s) 195, 231
Cfr13I GGNCC 2 cut(s) 34, 40
CsiI ACCWGGT 1 cut(s) 114
CviAII CATG 1 cut(s) 83
CviJI RGCY 5 cut(s) 5, 76, 195, 231, 249
CviKI_1 RGCY 5 cut(s) 5, 76, 195, 231, 249
DdeI CTNAG 1 cut(s) 201
Eco130I CCWWGG 1 cut(s) 43
Eco147I AGGCCT 1 cut(s) 195
Eco47I GGWCC 2 cut(s) 34, 40
EcoRII CCWGG 2 cut(s) 36, 114
EcoT14I CCWWGG 1 cut(s) 43
ErhI CCWWGG 1 cut(s) 43
FaeI CATG 1 cut(s) 86
FaiI YATR 5 cut(s) 54, 84, 169, 171, 173
FatI CATG 1 cut(s) 82
Fnu4HI GCNGC 2 cut(s) 6, 247
Fsp4HI GCNGC 2 cut(s) 6, 247
FspBI CTAG 2 cut(s) 65, 358
GluI GCNGC 2 cut(s) 6, 247
HaeIII GGCC 2 cut(s) 195, 231
Hin1II CATG 1 cut(s) 86
HinfI GANTC 1 cut(s) 60
Hpy188III TCNNGA 1 cut(s) 277
HpyAV CCTTC 1 cut(s) 341
HpyCH4III ACNGT 2 cut(s) 293, 340
HpyF10VI GCNNNNNNNGC 1 cut(s) 255
HpyF3I CTNAG 1 cut(s) 201
Hsp92II CATG 1 cut(s) 86
LpnPI CCDG 9 cut(s) 23, 41, 50, 101, 128, 136, 177, 189, 221
Lsp1109I GCAGC 1 cut(s) 258
LweI GCATC 1 cut(s) 127
MabI ACCWGGT 1 cut(s) 114
MaeI CTAG 2 cut(s) 65, 358
MboII GAAGA 2 cut(s) 8, 356
MhlI GDGCHC 1 cut(s) 207
MmeI TCCRAC 1 cut(s) 12
MnlI CCTC 2 cut(s) 135, 273
MseI TTAA 2 cut(s) 234, 260
MspR9I CCNGG 2 cut(s) 38, 116
MvaI CCWGG 2 cut(s) 38, 116
MwoI GCNNNNNNNGC 1 cut(s) 255
NlaIII CATG 1 cut(s) 86
PceI AGGCCT 1 cut(s) 195
PfeI GAWTC 1 cut(s) 60
PflMI CCANNNNNTGG 1 cut(s) 182
PkrI GCNGC 2 cut(s) 7, 248
Psp6I CCWGG 2 cut(s) 36, 114
PspGI CCWGG 2 cut(s) 36, 114
PspPI GGNCC 2 cut(s) 34, 40
SaqAI TTAA 2 cut(s) 234, 260
SatI GCNGC 2 cut(s) 6, 247
Sau96I GGNCC 2 cut(s) 34, 40
ScrFI CCNGG 2 cut(s) 38, 116
SduI GDGCHC 1 cut(s) 207
SetI ASST 4 cut(s) 39, 45, 78, 120
SexAI ACCWGGT 1 cut(s) 114
SfaNI GCATC 1 cut(s) 127
SinI GGWCC 2 cut(s) 34, 40
SseBI AGGCCT 1 cut(s) 195
SsiI CCGC 1 cut(s) 8
SspI AATATT 1 cut(s) 94
SspMI CTAG 2 cut(s) 65, 358
StuI AGGCCT 1 cut(s) 195
StyD4I CCNGG 2 cut(s) 36, 114
StyI CCWWGG 1 cut(s) 43
TaaI ACNGT 2 cut(s) 293, 340
TfiI GAWTC 1 cut(s) 60
Tru1I TTAA 2 cut(s) 234, 260
Tru9I TTAA 2 cut(s) 234, 260
TseI GCWGC 2 cut(s) 5, 246
Van91I CCANNNNNTGG 1 cut(s) 182
VpaK11BI GGWCC 2 cut(s) 34, 40
XspI CTAG 2 cut(s) 65, 358
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.