Rh3DG001700

Catalyzes the ATP-dependent amination of UTP to CTP with either L-glutamine or ammonia as the source of nitrogen

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
195331 .. 198149
2819 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG001700.1

Sequence Viewer

Length: 240 bp
ATGGCTGCGGACTATCTTCTCTCAACCCAGGTTATCCCTCACATCACAGATGCTATCCAAGACTGGATTAGGCGTGTAGCATATATACCAGTTGATGGAAAGTCAGGCCTTGCTGAGCACCAGTATTGGTCATTTGGTCTTGGCCTTAATCTTTGGGGCAGCCTTGATTGCTTAAAAGCAGTTTGCTTCAAGAGGGTAATCACTCAAACTCAATCCTTTCTAGTATCTATTCTTGTTTGA

Protein Analysis

79

Amino Acids

8.88

Weight (kDa)

6.69

Isoelectric Point (pI)

30.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 95
AciI CCGC 1 cut(s) 8
AfiI CCNNNNNNNGG 1 cut(s) 95
AgsI TTSAA 1 cut(s) 190
AjnI CCWGG 1 cut(s) 27
Alw21I GWGCWC 1 cut(s) 120
AoxI GGCC 2 cut(s) 106, 142
ApeKI GCWGC 2 cut(s) 5, 159
Bbv12I GWGCWC 1 cut(s) 120
BbvI GCAGC 1 cut(s) 171
BccI CCATC 1 cut(s) 89
BciT130I CCWGG 1 cut(s) 29
BfaI CTAG 1 cut(s) 221
BisI GCNGC 2 cut(s) 6, 160
BlpI GCTNAGC 1 cut(s) 114
BlsI GCNGC 2 cut(s) 7, 161
Bme1390I CCNGG 1 cut(s) 29
BmrFI CCNGG 1 cut(s) 29
BmsI GCATC 1 cut(s) 40
Bpu1102I GCTNAGC 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 27
Bsc4I CCNNNNNNNGG 1 cut(s) 95
Bse1I ACTGG 3 cut(s) 68, 89, 121
BseBI CCWGG 1 cut(s) 29
BseDI CCNNGG 1 cut(s) 27
BseLI CCNNNNNNNGG 1 cut(s) 95
BseMII CTCAG 1 cut(s) 105
BseNI ACTGG 3 cut(s) 68, 89, 121
BseXI GCAGC 1 cut(s) 171
BshFI GGCC 2 cut(s) 108, 144
BsiHKAI GWGCWC 1 cut(s) 120
BslI CCNNNNNNNGG 1 cut(s) 95
BsnI GGCC 2 cut(s) 108, 144
Bsp1286I GDGCHC 1 cut(s) 120
Bsp1720I GCTNAGC 1 cut(s) 114
BspACI CCGC 1 cut(s) 8
BspANI GGCC 2 cut(s) 108, 144
BspCNI CTCAG 1 cut(s) 106
BsrI ACTGG 3 cut(s) 68, 89, 121
BssECI CCNNGG 1 cut(s) 27
Bst2UI CCWGG 1 cut(s) 29
BstDEI CTNAG 1 cut(s) 114
BstMWI GCNNNNNNNGC 1 cut(s) 168
BstNI CCWGG 1 cut(s) 29
BstSCI CCNGG 1 cut(s) 27
BstV1I GCAGC 1 cut(s) 171
BsuRI GGCC 2 cut(s) 108, 144
CviJI RGCY 4 cut(s) 5, 108, 144, 162
CviKI_1 RGCY 4 cut(s) 5, 108, 144, 162
DdeI CTNAG 1 cut(s) 114
Eco147I AGGCCT 1 cut(s) 108
EcoRII CCWGG 1 cut(s) 27
FaiI YATR 3 cut(s) 82, 84, 86
Fnu4HI GCNGC 2 cut(s) 6, 160
Fsp4HI GCNGC 2 cut(s) 6, 160
FspBI CTAG 1 cut(s) 221
GluI GCNGC 2 cut(s) 6, 160
HaeIII GGCC 2 cut(s) 108, 144
Hpy188III TCNNGA 1 cut(s) 190
HpyF10VI GCNNNNNNNGC 1 cut(s) 168
HpyF3I CTNAG 1 cut(s) 114
LpnPI CCDG 6 cut(s) 14, 41, 49, 90, 102, 134
Lsp1109I GCAGC 1 cut(s) 171
LweI GCATC 1 cut(s) 40
MaeI CTAG 1 cut(s) 221
MboII GAAGA 1 cut(s) 8
MhlI GDGCHC 1 cut(s) 120
MnlI CCTC 2 cut(s) 48, 186
MseI TTAA 2 cut(s) 147, 173
MspR9I CCNGG 1 cut(s) 29
MvaI CCWGG 1 cut(s) 29
MwoI GCNNNNNNNGC 1 cut(s) 168
PceI AGGCCT 1 cut(s) 108
PflMI CCANNNNNTGG 1 cut(s) 95
PkrI GCNGC 2 cut(s) 7, 161
Psp6I CCWGG 1 cut(s) 27
PspGI CCWGG 1 cut(s) 27
SaqAI TTAA 2 cut(s) 147, 173
SatI GCNGC 2 cut(s) 6, 160
ScrFI CCNGG 1 cut(s) 29
SduI GDGCHC 1 cut(s) 120
SetI ASST 1 cut(s) 33
SfaNI GCATC 1 cut(s) 40
SseBI AGGCCT 1 cut(s) 108
SsiI CCGC 1 cut(s) 8
SspMI CTAG 1 cut(s) 221
StuI AGGCCT 1 cut(s) 108
StyD4I CCNGG 1 cut(s) 27
Tru1I TTAA 2 cut(s) 147, 173
Tru9I TTAA 2 cut(s) 147, 173
TseI GCWGC 2 cut(s) 5, 159
Van91I CCANNNNNTGG 1 cut(s) 95
XspI CTAG 1 cut(s) 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.