Rh3AG001900

Catalyzes the ATP-dependent amination of UTP to CTP with either L-glutamine or ammonia as the source of nitrogen

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Forward (+)
196214 .. 197922
1709 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG001900.1

Sequence Viewer

Length: 189 bp
ATGCCACAACTGACAAAGGTTATCCCTCACATCACAGATGCTATCCAAGACTGGATTAGGCGTGTAGCATATATACCAGTTGATGGAAAGTCAGGCCTTGCTGAGCACCAGTATTGGTCATTTGGTCTTGGCCTTAATCTTTGGGGCAGCCTTGATTGCTTAAAAGCAGTTTGCTTCAAGAGGGGTTGA

Protein Analysis

62

Amino Acids

7.01

Weight (kDa)

8.74

Isoelectric Point (pI)

37.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 83
AfiI CCNNNNNNNGG 1 cut(s) 83
AgsI TTSAA 1 cut(s) 178
Alw21I GWGCWC 1 cut(s) 108
AoxI GGCC 2 cut(s) 94, 130
ApeKI GCWGC 1 cut(s) 147
Bbv12I GWGCWC 1 cut(s) 108
BbvI GCAGC 1 cut(s) 159
BccI CCATC 1 cut(s) 77
BisI GCNGC 1 cut(s) 148
BlpI GCTNAGC 1 cut(s) 102
BlsI GCNGC 1 cut(s) 149
BmsI GCATC 1 cut(s) 28
Bpu1102I GCTNAGC 1 cut(s) 102
Bsc4I CCNNNNNNNGG 1 cut(s) 83
Bse1I ACTGG 3 cut(s) 56, 77, 109
BseLI CCNNNNNNNGG 1 cut(s) 83
BseMII CTCAG 1 cut(s) 93
BseNI ACTGG 3 cut(s) 56, 77, 109
BseXI GCAGC 1 cut(s) 159
BshFI GGCC 2 cut(s) 96, 132
BsiHKAI GWGCWC 1 cut(s) 108
BslI CCNNNNNNNGG 1 cut(s) 83
BsnI GGCC 2 cut(s) 96, 132
Bsp1286I GDGCHC 1 cut(s) 108
Bsp1720I GCTNAGC 1 cut(s) 102
BspANI GGCC 2 cut(s) 96, 132
BspCNI CTCAG 1 cut(s) 94
BsrI ACTGG 3 cut(s) 56, 77, 109
BstDEI CTNAG 1 cut(s) 102
BstMWI GCNNNNNNNGC 1 cut(s) 156
BstV1I GCAGC 1 cut(s) 159
BsuRI GGCC 2 cut(s) 96, 132
CviJI RGCY 3 cut(s) 96, 132, 150
CviKI_1 RGCY 3 cut(s) 96, 132, 150
DdeI CTNAG 1 cut(s) 102
Eco147I AGGCCT 1 cut(s) 96
FaiI YATR 3 cut(s) 70, 72, 74
Fnu4HI GCNGC 1 cut(s) 148
Fsp4HI GCNGC 1 cut(s) 148
GluI GCNGC 1 cut(s) 148
HaeIII GGCC 2 cut(s) 96, 132
Hpy188III TCNNGA 1 cut(s) 178
HpyF10VI GCNNNNNNNGC 1 cut(s) 156
HpyF3I CTNAG 1 cut(s) 102
LpnPI CCDG 4 cut(s) 37, 78, 90, 122
Lsp1109I GCAGC 1 cut(s) 159
LweI GCATC 1 cut(s) 28
MhlI GDGCHC 1 cut(s) 108
MnlI CCTC 2 cut(s) 36, 174
MseI TTAA 2 cut(s) 135, 161
MwoI GCNNNNNNNGC 1 cut(s) 156
PceI AGGCCT 1 cut(s) 96
PflMI CCANNNNNTGG 1 cut(s) 83
PkrI GCNGC 1 cut(s) 149
SaqAI TTAA 2 cut(s) 135, 161
SatI GCNGC 1 cut(s) 148
SduI GDGCHC 1 cut(s) 108
SetI ASST 1 cut(s) 21
SfaNI GCATC 1 cut(s) 28
SgeI CNNG 9 cut(s) 59, 64, 74, 89, 105, 110, 121, 140, 164
SseBI AGGCCT 1 cut(s) 96
StuI AGGCCT 1 cut(s) 96
Tru1I TTAA 2 cut(s) 135, 161
Tru9I TTAA 2 cut(s) 135, 161
TseI GCWGC 1 cut(s) 147
Van91I CCANNNNNTGG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.