Rh2AG526900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
75552191 .. 75560329
8139 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG526900.1

Sequence Viewer

Length: 192 bp
ATGAAGATAAAGTTCTACACTTCATCCCCCAAGTTCCCGGATGCCATTTCTCTAGAGGATTGTGTTCCTCCCATATTTCTCAATTATGACATCTTTGCCTTTAGCGGTTGTCAGTGGCAATATCAAGCCTTACCAAGAATTCTAAAACCACTCCACAAATTTTATTCTTCCAAAAAGGTATTATTAGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.37

Weight (kDa)

9.26

Isoelectric Point (pI)

45.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 105
AcsI RAATTY 2 cut(s) 138, 158
ApoI RAATTY 2 cut(s) 138, 158
AsuC2I CCSGG 1 cut(s) 38
BcnI CCSGG 1 cut(s) 38
BfaI CTAG 2 cut(s) 53, 190
Bme1390I CCNGG 1 cut(s) 38
BmrFI CCNGG 1 cut(s) 38
BmsI GCATC 1 cut(s) 31
BpuMI CCSGG 1 cut(s) 38
BseGI GGATG 2 cut(s) 23, 46
BsiSI CCGG 1 cut(s) 38
BspACI CCGC 1 cut(s) 105
BstF5I GGATG 2 cut(s) 23, 46
BstSCI CCNGG 1 cut(s) 36
BtsCI GGATG 2 cut(s) 23, 46
BtsIMutI CAGTG 1 cut(s) 119
CviJI RGCY 1 cut(s) 128
CviKI_1 RGCY 1 cut(s) 128
EcoRI GAATTC 1 cut(s) 138
FaiI YATR 2 cut(s) 74, 87
FokI GGATG 2 cut(s) 10, 53
FspBI CTAG 2 cut(s) 53, 190
HapII CCGG 1 cut(s) 38
HpaII CCGG 1 cut(s) 38
Hpy188III TCNNGA 1 cut(s) 53
LpnPI CCDG 1 cut(s) 51
LweI GCATC 1 cut(s) 31
MaeI CTAG 2 cut(s) 53, 190
MboII GAAGA 2 cut(s) 16, 159
MluCI AATT 3 cut(s) 82, 138, 158
MnlI CCTC 2 cut(s) 49, 78
MspI CCGG 1 cut(s) 38
MspR9I CCNGG 1 cut(s) 38
NciI CCSGG 1 cut(s) 38
PfoI TCCNGGA 1 cut(s) 36
ScrFI CCNGG 1 cut(s) 38
SetI ASST 1 cut(s) 180
SfaNI GCATC 1 cut(s) 31
SgeI CNNG 6 cut(s) 43, 49, 50, 65, 137, 147
Sse9I AATT 3 cut(s) 82, 138, 158
SsiI CCGC 1 cut(s) 105
SspMI CTAG 2 cut(s) 53, 190
StyD4I CCNGG 1 cut(s) 36
TasI AATT 3 cut(s) 82, 138, 158
TscAI CASTG 1 cut(s) 119
TspDTI ATGAA 2 cut(s) 12, 17
TspRI CASTG 1 cut(s) 119
XapI RAATTY 2 cut(s) 138, 158
XbaI TCTAGA 1 cut(s) 52
XspI CTAG 2 cut(s) 53, 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.