Rroxscaffold_5G00381150

Catalyzes the ATP-dependent amination of UTP to CTP with either L-glutamine or ammonia as the source of nitrogen

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
61212959 .. 61214774
1816 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00381150.1

Sequence Viewer

Length: 465 bp
ATGGCCGTGGACTATCTTCTCTCAACCCAGTTGGACCTGGACCTTGGAAACTATGAGCGATTCCTAGAAATCAACTTGACCCGTGATAACAATATTTCTACCGGAATGATTTACCAGGTTGTCCCTCACATCACAGATGCTATCCAAGACTGGATTAAGCGTGTAGCATATATACTAGTTGATGGCAAGTCAGGCCCTGCTGAGATGTCTACAATGATCTTATATCCCGTTGAGTTCTTTTCTAGTGATGCTGAGAAATTTGCAGAAGAATGTCCTTGTTGTACTGGTTGTAGATCGGGTCGCATCATTTGCCATGTACCTTGGTCTTGTGATTTTGGCTTGAGGTCTGCTACTGTGCCTATCTATCACATTCAAAGGGCAAAACACTTCCTTTTATTACCGTTGAAGAAGGTACTTGCAGGTCTTGGGTTCTCTTTTATAGTGTTCTGTGATTCATCTTATTGA

Protein Analysis

154

Amino Acids

17.4

Weight (kDa)

5.47

Isoelectric Point (pI)

54.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CTP_synth_N PF06418 10 - 41 1e-08 CTP synthase N-terminus
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 410
AccI GTMKAC 1 cut(s) 209
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 257
AfaI GTAC 3 cut(s) 283, 318, 414
AgsI TTSAA 2 cut(s) 374, 406
AhlI ACTAGT 1 cut(s) 175
AjnI CCWGG 2 cut(s) 36, 114
AlwNI CAGNNNCTG 1 cut(s) 197
AoxI GGCC 2 cut(s) 3, 193
ApoI RAATTY 1 cut(s) 257
AspS9I GGNCC 3 cut(s) 34, 40, 194
AvaII GGWCC 2 cut(s) 34, 40
BccI CCATC 1 cut(s) 176
BciT130I CCWGG 2 cut(s) 38, 116
BcuI ACTAGT 1 cut(s) 175
BfaI CTAG 3 cut(s) 65, 176, 243
BfuAI ACCTGC 1 cut(s) 410
Bme1390I CCNGG 2 cut(s) 38, 116
Bme18I GGWCC 2 cut(s) 34, 40
BmgT120I GGNCC 3 cut(s) 34, 40, 194
BmrFI CCNGG 2 cut(s) 38, 116
BmrI ACTGGG 1 cut(s) 22
BmsI GCATC 3 cut(s) 127, 238, 312
BmuI ACTGGG 1 cut(s) 22
BpuEI CTTGAG 1 cut(s) 361
BsaJI CCNNGG 3 cut(s) 6, 43, 320
BsaWI WCCGGW 1 cut(s) 101
Bse1I ACTGG 3 cut(s) 28, 155, 289
BseBI CCWGG 2 cut(s) 38, 116
BseDI CCNNGG 3 cut(s) 6, 43, 320
BseMII CTCAG 2 cut(s) 192, 243
BseNI ACTGG 3 cut(s) 28, 155, 289
BshFI GGCC 2 cut(s) 5, 195
BsiSI CCGG 1 cut(s) 102
BslFI GGGAC 1 cut(s) 107
BsmFI GGGAC 1 cut(s) 107
BsnI GGCC 2 cut(s) 5, 195
Bsp143I GATC 2 cut(s) 216, 293
BspANI GGCC 2 cut(s) 5, 195
BspCNI CTCAG 2 cut(s) 193, 244
BspMI ACCTGC 1 cut(s) 410
BsrI ACTGG 3 cut(s) 28, 155, 289
BssECI CCNNGG 3 cut(s) 6, 43, 320
BssMI GATC 2 cut(s) 216, 293
BssT1I CCWWGG 2 cut(s) 43, 320
Bst2UI CCWGG 2 cut(s) 38, 116
Bst4CI ACNGT 2 cut(s) 355, 402
BstAPI GCANNNNNTGC 1 cut(s) 309
BstDEI CTNAG 2 cut(s) 201, 252
BstDSI CCRYGG 1 cut(s) 6
BstKTI GATC 2 cut(s) 219, 296
BstMBI GATC 2 cut(s) 216, 293
BstMWI GCNNNNNNNGC 2 cut(s) 192, 309
BstNI CCWGG 2 cut(s) 38, 116
BstSCI CCNGG 2 cut(s) 36, 114
BsuRI GGCC 2 cut(s) 5, 195
BtgI CCRYGG 1 cut(s) 6
BveI ACCTGC 1 cut(s) 410
CaiI CAGNNNCTG 1 cut(s) 197
Cfr13I GGNCC 3 cut(s) 34, 40, 194
CsiI ACCWGGT 1 cut(s) 114
Csp6I GTAC 3 cut(s) 282, 317, 413
CviAII CATG 1 cut(s) 314
CviJI RGCY 3 cut(s) 5, 195, 339
CviKI_1 RGCY 3 cut(s) 5, 195, 339
CviQI GTAC 3 cut(s) 282, 317, 413
DdeI CTNAG 2 cut(s) 201, 252
DpnI GATC 2 cut(s) 218, 295
DpnII GATC 2 cut(s) 216, 293
EaeI YGGCCR 1 cut(s) 3
Eco130I CCWWGG 2 cut(s) 43, 320
Eco47I GGWCC 2 cut(s) 34, 40
EcoO109I RGGNCCY 1 cut(s) 194
EcoRII CCWGG 2 cut(s) 36, 114
EcoT14I CCWWGG 2 cut(s) 43, 320
ErhI CCWWGG 2 cut(s) 43, 320
FaeI CATG 1 cut(s) 317
FaiI YATR 7 cut(s) 54, 169, 171, 173, 223, 315, 440
FaqI GGGAC 1 cut(s) 107
FatI CATG 1 cut(s) 313
FblI GTMKAC 1 cut(s) 209
FspBI CTAG 3 cut(s) 65, 176, 243
HaeIII GGCC 2 cut(s) 5, 195
HapII CCGG 1 cut(s) 102
Hin1II CATG 1 cut(s) 317
HinfI GANTC 2 cut(s) 60, 452
HpaII CCGG 1 cut(s) 102
Hpy166II GTNNAC 2 cut(s) 10, 210
Hpy8I GTNNAC 2 cut(s) 10, 210
HpyAV CCTTC 1 cut(s) 403
HpyCH4III ACNGT 2 cut(s) 355, 402
HpyCH4V TGCA 2 cut(s) 263, 419
HpyF10VI GCNNNNNNNGC 2 cut(s) 192, 309
HpyF3I CTNAG 2 cut(s) 201, 252
Hsp92II CATG 1 cut(s) 317
Kzo9I GATC 2 cut(s) 216, 293
LweI GCATC 3 cut(s) 127, 238, 312
MabI ACCWGGT 1 cut(s) 114
MaeI CTAG 3 cut(s) 65, 176, 243
MalI GATC 2 cut(s) 218, 295
MboI GATC 2 cut(s) 216, 293
MboII GAAGA 3 cut(s) 8, 278, 418
MluCI AATT 1 cut(s) 257
MmeI TCCRAC 1 cut(s) 12
MnlI CCTC 2 cut(s) 135, 336
MseI TTAA 1 cut(s) 156
MspI CCGG 1 cut(s) 102
MspR9I CCNGG 2 cut(s) 38, 116
MvaI CCWGG 2 cut(s) 38, 116
MwoI GCNNNNNNNGC 2 cut(s) 192, 309
NdeII GATC 2 cut(s) 216, 293
NlaIII CATG 1 cut(s) 317
PfeI GAWTC 2 cut(s) 60, 452
Psp6I CCWGG 2 cut(s) 36, 114
PspGI CCWGG 2 cut(s) 36, 114
PspPI GGNCC 3 cut(s) 34, 40, 194
PstNI CAGNNNCTG 1 cut(s) 197
RsaI GTAC 3 cut(s) 283, 318, 414
RsaNI GTAC 3 cut(s) 282, 317, 413
SaqAI TTAA 1 cut(s) 156
Sau3AI GATC 2 cut(s) 216, 293
Sau96I GGNCC 3 cut(s) 34, 40, 194
ScrFI CCNGG 2 cut(s) 38, 116
SetI ASST 7 cut(s) 39, 45, 120, 322, 347, 414, 424
SexAI ACCWGGT 1 cut(s) 114
SfaNI GCATC 3 cut(s) 127, 238, 312
SinI GGWCC 2 cut(s) 34, 40
SmlI CTYRAG 1 cut(s) 340
SmoI CTYRAG 1 cut(s) 340
SpeI ACTAGT 1 cut(s) 175
Sse9I AATT 1 cut(s) 257
SspI AATATT 1 cut(s) 94
SspMI CTAG 3 cut(s) 65, 176, 243
StyD4I CCNGG 2 cut(s) 36, 114
StyI CCWWGG 2 cut(s) 43, 320
TaaI ACNGT 2 cut(s) 355, 402
TasI AATT 1 cut(s) 257
TatI WGTACW 1 cut(s) 281
TfiI GAWTC 2 cut(s) 60, 452
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
TspDTI ATGAA 1 cut(s) 444
VpaK11BI GGWCC 2 cut(s) 34, 40
XapI RAATTY 1 cut(s) 257
XmiI GTMKAC 1 cut(s) 209
XspI CTAG 3 cut(s) 65, 176, 243
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.