RchiOBHm_Chr5g0025971

Vacuolar amino acid transporter 1-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
19952548 .. 19954646
2099 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30557

Sequence Viewer

Length: 183 bp
ATGATGACATGCTACTTAAAGCATGCACGTGACCCATCAGTAACAGCCTATCTCGATATTGTTGAACGAGCATTCAACAATAGATCGTGGATTATAGCTTCCCTGTTTTTAAACAAAGAACTATACTTAGTCGCTCTCCAAGCCGAGATAGCTGAAAGTGACAAAATTGGCATAATTTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

6.92

Weight (kDa)

5.62

Isoelectric Point (pI)

26.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcvI CACGTG 1 cut(s) 29
AgsI TTSAA 2 cut(s) 65, 76
AluBI AGCT 2 cut(s) 98, 152
AluI AGCT 2 cut(s) 98, 152
BbrPI CACGTG 1 cut(s) 29
BccI CCATC 1 cut(s) 43
BsaAI YACGTR 1 cut(s) 29
BsmI GAATGC 1 cut(s) 71
Bsp143I GATC 1 cut(s) 83
BssMI GATC 1 cut(s) 83
BstBAI YACGTR 1 cut(s) 29
BstC8I GCNNGC 1 cut(s) 24
BstDEI CTNAG 1 cut(s) 127
BstKTI GATC 1 cut(s) 86
BstMBI GATC 1 cut(s) 83
BstMWI GCNNNNNNNGC 2 cut(s) 140, 149
BstNSI RCATGY 2 cut(s) 12, 26
Cac8I GCNNGC 1 cut(s) 24
CviAII CATG 2 cut(s) 9, 23
CviJI RGCY 4 cut(s) 47, 98, 143, 152
CviKI_1 RGCY 4 cut(s) 47, 98, 143, 152
DdeI CTNAG 1 cut(s) 127
DpnI GATC 1 cut(s) 85
DpnII GATC 1 cut(s) 83
DraI TTTAAA 1 cut(s) 111
Eco72I CACGTG 1 cut(s) 29
FaeI CATG 2 cut(s) 12, 26
FaiI YATR 5 cut(s) 10, 24, 95, 124, 173
FatI CATG 2 cut(s) 8, 22
FspEI CC 9 cut(s) 47, 48, 61, 73, 115, 116, 152, 153, 157
Hin1II CATG 2 cut(s) 12, 26
Hpy188III TCNNGA 1 cut(s) 53
HpyCH4IV ACGT 1 cut(s) 28
HpyCH4V TGCA 1 cut(s) 26
HpyF10VI GCNNNNNNNGC 2 cut(s) 140, 149
HpyF3I CTNAG 1 cut(s) 127
HpySE526I ACGT 1 cut(s) 28
Hsp92II CATG 2 cut(s) 12, 26
Kzo9I GATC 1 cut(s) 83
LpnPI CCDG 1 cut(s) 116
MaeII ACGT 1 cut(s) 28
MaeIII GTNAC 3 cut(s) 29, 40, 158
MalI GATC 1 cut(s) 85
MboI GATC 1 cut(s) 83
MluCI AATT 2 cut(s) 165, 174
MseI TTAA 3 cut(s) 17, 110, 181
MslI CAYNNNNRTG 1 cut(s) 27
Mva1269I GAATGC 1 cut(s) 71
MwoI GCNNNNNNNGC 2 cut(s) 140, 149
NdeII GATC 1 cut(s) 83
NlaIII CATG 2 cut(s) 12, 26
NmeAIII GCCGAG 1 cut(s) 169
NmuCI GTSAC 2 cut(s) 29, 158
NspI RCATGY 2 cut(s) 12, 26
PaeI GCATGC 1 cut(s) 26
PctI GAATGC 1 cut(s) 71
PmaCI CACGTG 1 cut(s) 29
PmlI CACGTG 1 cut(s) 29
Ppu21I YACGTR 1 cut(s) 29
PspCI CACGTG 1 cut(s) 29
RseI CAYNNNNRTG 1 cut(s) 27
SaqAI TTAA 3 cut(s) 17, 110, 181
Sau3AI GATC 1 cut(s) 83
SetI ASST 3 cut(s) 31, 100, 154
SmiMI CAYNNNNRTG 1 cut(s) 27
SphI GCATGC 1 cut(s) 26
Sse9I AATT 2 cut(s) 165, 174
TaiI ACGT 1 cut(s) 31
TaqI TCGA 1 cut(s) 54
TasI AATT 2 cut(s) 165, 174
Tru1I TTAA 3 cut(s) 17, 110, 181
Tru9I TTAA 3 cut(s) 17, 110, 181
TseFI GTSAC 2 cut(s) 29, 158
Tsp45I GTSAC 2 cut(s) 29, 158
XceI RCATGY 2 cut(s) 12, 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.