RchiOBHm_Chr5g0057311

Transmembrane amino acid transporter protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0006420
Physical Location & Seq
Reverse (-)
61227270 .. 61227614
345 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33409

Sequence Viewer

Length: 345 bp
ATGTTTATAGCTGTGATTGGCTATCTGATGTACGGAGCAGAAGTACAATCTCAAATTACCTTCAACCTTCCCACCTCAGAAGTCGGTGCAAAAGTAGCCATTTATACATTACTATTGATACCTATTACCCTGTATGCTCTGATTATTACCCCCATAGCTTTAGCTATTGAGGATGTCCTTCCTCAGACCTATCAAAATAGGAATTTAATACAGATAGGTATTAGGCTAGTAATTATGGCTAGCAATACCTTATTAGCCAATGGGCCTACTAGGATCCATTTTTGTTGTCTCAGCATCTTTTTTACTGCTTTGTGCATGCTACATCAAGCTTACTCATGGCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04721 ko04723 ko04727 ko05032 ko05033 map04721 map04723 map04727 map05032 map05033
Pfam Domains
Protein Families
Aa_trans

Protein Analysis

114

Amino Acids

12.69

Weight (kDa)

6.69

Isoelectric Point (pI)

32.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Aa_trans PF01490 1 - 86 9.6e-07 Transmembrane amino acid transporter protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 268, 281
AcsI RAATTY 1 cut(s) 202
AfaI GTAC 2 cut(s) 32, 45
AgsI TTSAA 1 cut(s) 64
AluBI AGCT 4 cut(s) 11, 158, 164, 329
AluI AGCT 4 cut(s) 11, 158, 164, 329
Alw26I GTCTC 1 cut(s) 293
AlwI GGATC 2 cut(s) 268, 281
AoxI GGCC 1 cut(s) 263
ApoI RAATTY 1 cut(s) 202
AspS9I GGNCC 1 cut(s) 263
AsuNHI GCTAGC 1 cut(s) 239
BamHI GGATCC 1 cut(s) 273
BcoDI GTCTC 1 cut(s) 293
BfaI CTAG 3 cut(s) 227, 240, 270
BmgT120I GGNCC 1 cut(s) 263
BmiI GGNNCC 1 cut(s) 275
BmsI GCATC 1 cut(s) 303
BmtI GCTAGC 1 cut(s) 243
BsaXI ACNNNNNCTCC 2 cut(s) 27, 57
BseGI GGATG 1 cut(s) 178
BseMII CTCAG 3 cut(s) 90, 197, 304
BshFI GGCC 1 cut(s) 265
BsmAI GTCTC 1 cut(s) 293
BsnI GGCC 1 cut(s) 265
Bsp143I GATC 1 cut(s) 273
BspANI GGCC 1 cut(s) 265
BspCNI CTCAG 3 cut(s) 89, 196, 303
BspLI GGNNCC 1 cut(s) 275
BspOI GCTAGC 1 cut(s) 243
BspPI GGATC 2 cut(s) 268, 281
BssMI GATC 1 cut(s) 273
BstC8I GCNNGC 2 cut(s) 241, 317
BstDEI CTNAG 3 cut(s) 76, 183, 290
BstF5I GGATG 1 cut(s) 178
BstKTI GATC 1 cut(s) 276
BstMAI GTCTC 1 cut(s) 293
BstMBI GATC 1 cut(s) 273
BstMWI GCNNNNNNNGC 1 cut(s) 95
BstNSI RCATGY 1 cut(s) 319
BstX2I RGATCY 1 cut(s) 273
BstYI RGATCY 1 cut(s) 273
BsuRI GGCC 1 cut(s) 265
BtsCI GGATG 1 cut(s) 178
Cac8I GCNNGC 2 cut(s) 241, 317
Cfr13I GGNCC 1 cut(s) 263
Csp6I GTAC 2 cut(s) 31, 44
CviAII CATG 2 cut(s) 316, 336
CviQI GTAC 2 cut(s) 31, 44
DdeI CTNAG 3 cut(s) 76, 183, 290
DpnI GATC 1 cut(s) 275
DpnII GATC 1 cut(s) 273
FaeI CATG 2 cut(s) 319, 339
FaiI YATR 7 cut(s) 8, 105, 135, 155, 236, 317, 337
FatI CATG 2 cut(s) 315, 335
FokI GGATG 1 cut(s) 185
FspBI CTAG 3 cut(s) 227, 240, 270
HaeIII GGCC 1 cut(s) 265
Hin1II CATG 2 cut(s) 319, 339
HindIII AAGCTT 1 cut(s) 327
Hpy188I TCNGA 4 cut(s) 27, 79, 141, 186
HpyAV CCTTC 3 cut(s) 70, 77, 188
HpyCH4V TGCA 2 cut(s) 89, 315
HpyF10VI GCNNNNNNNGC 1 cut(s) 95
HpyF3I CTNAG 3 cut(s) 76, 183, 290
Hsp92II CATG 2 cut(s) 319, 339
Kzo9I GATC 1 cut(s) 273
LmnI GCTCC 1 cut(s) 35
LpnPI CCDG 1 cut(s) 143
LweI GCATC 1 cut(s) 303
MaeI CTAG 3 cut(s) 227, 240, 270
MalI GATC 1 cut(s) 275
MboI GATC 1 cut(s) 273
MflI RGATCY 1 cut(s) 273
MluCI AATT 3 cut(s) 54, 202, 231
MnlI CCTC 3 cut(s) 85, 163, 192
MseI TTAA 1 cut(s) 206
MwoI GCNNNNNNNGC 1 cut(s) 95
NdeII GATC 1 cut(s) 273
NheI GCTAGC 1 cut(s) 239
NlaIII CATG 2 cut(s) 319, 339
NlaIV GGNNCC 1 cut(s) 275
NspI RCATGY 1 cut(s) 319
PaeI GCATGC 1 cut(s) 319
PspN4I GGNNCC 1 cut(s) 275
PspPI GGNCC 1 cut(s) 263
PsuI RGATCY 1 cut(s) 273
RsaI GTAC 2 cut(s) 32, 45
RsaNI GTAC 2 cut(s) 31, 44
SaqAI TTAA 1 cut(s) 206
Sau3AI GATC 1 cut(s) 273
Sau96I GGNCC 1 cut(s) 263
SfaNI GCATC 1 cut(s) 303
SgeI CNNG 6 cut(s) 142, 239, 252, 282, 328, 338
SphI GCATGC 1 cut(s) 319
Sse9I AATT 3 cut(s) 54, 202, 231
SspMI CTAG 3 cut(s) 227, 240, 270
TasI AATT 3 cut(s) 54, 202, 231
TatI WGTACW 1 cut(s) 43
Tru1I TTAA 1 cut(s) 206
Tru9I TTAA 1 cut(s) 206
TspGWI ACGGA 1 cut(s) 48
XapI RAATTY 1 cut(s) 202
XceI RCATGY 1 cut(s) 319
XspI CTAG 3 cut(s) 227, 240, 270
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.