RchiOBHm_Chr7g0183941

ribosomal protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0003734
Physical Location & Seq
Forward (+)
4672507 .. 4673397
891 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ16412

Sequence Viewer

Length: 447 bp
ATGGTGAGAGTTAGCGTGCTGAATGATGCTCTCAAGAGCATGTACAATGCAGAGAAACGTGGTAAGCGTCAGGTGATGATCAGGCCGTCATCCAAAGTGATCATCAAGTTTCTTATTGTCATGCAAAAGCATGGATACATTGGAGAGTTCGAGTATGTTGACGACCACAGCTCTGGCAAAATTGTGGTCGAACTGAATGGAAGGCTTAAAAAGTGTGGGGTCATTAGTCCTCGTTTTGATGTTGGTGTTAAGGAGATTGAAGGTTGGACTGCCAGGTTGCTTCCTTCAAGACAGGTGATTATATATAGTGTGACCTTGAATTTTGGATATATCGTGCTCACCACTTCTGCTGGAATCATGGACCATGAAGAGGCTAGAAGAAAGAATGTCATTTCTTCGAGATGTTCCATATTATGTTTGTATGCTGTTTATTTCTCCGTTTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_S8

Protein Analysis

148

Amino Acids

16.78

Weight (kDa)

9.56

Isoelectric Point (pI)

32.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S8 PF00410 7 - 130 3e-19 Ribosomal protein S8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 319
AfaI GTAC 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 370
AgsI TTSAA 3 cut(s) 260, 288, 319
AjnI CCWGG 1 cut(s) 272
AluBI AGCT 1 cut(s) 171
AluI AGCT 1 cut(s) 171
Alw21I GWGCWC 1 cut(s) 339
AoxI GGCC 1 cut(s) 83
ApoI RAATTY 1 cut(s) 319
ArsI GACNNNNNNTTYG 2 cut(s) 171, 203
AspS9I GGNCC 1 cut(s) 361
AsuHPI GGTGA 4 cut(s) 16, 85, 307, 331
AvaII GGWCC 1 cut(s) 361
Bbv12I GWGCWC 1 cut(s) 339
BceAI ACGGC 1 cut(s) 70
BciT130I CCWGG 1 cut(s) 274
BciVI GTATCC 1 cut(s) 128
BclI TGATCA 2 cut(s) 78, 99
BfaI CTAG 1 cut(s) 375
BfuI GTATCC 1 cut(s) 128
Bme1390I CCNGG 1 cut(s) 274
Bme18I GGWCC 1 cut(s) 361
BmgT120I GGNCC 1 cut(s) 361
BmrFI CCNGG 1 cut(s) 274
BmsI GCATC 1 cut(s) 16
BpuEI CTTGAG 1 cut(s) 17
Bsc4I CCNNNNNNNGG 1 cut(s) 370
BseBI CCWGG 1 cut(s) 274
BseGI GGATG 1 cut(s) 89
BseLI CCNNNNNNNGG 1 cut(s) 370
BshFI GGCC 1 cut(s) 85
BsiHKAI GWGCWC 1 cut(s) 339
BslI CCNNNNNNNGG 1 cut(s) 370
BsnI GGCC 1 cut(s) 85
Bsp1286I GDGCHC 1 cut(s) 339
Bsp1407I TGTACA 1 cut(s) 42
Bsp143I GATC 2 cut(s) 78, 99
BspANI GGCC 1 cut(s) 85
BsrGI TGTACA 1 cut(s) 42
BssMI GATC 2 cut(s) 78, 99
Bst2UI CCWGG 1 cut(s) 274
Bst6I CTCTTC 1 cut(s) 363
BstAUI TGTACA 1 cut(s) 42
BstC8I GCNNGC 1 cut(s) 17
BstF5I GGATG 1 cut(s) 89
BstKTI GATC 2 cut(s) 81, 102
BstMBI GATC 2 cut(s) 78, 99
BstNI CCWGG 1 cut(s) 274
BstNSI RCATGY 1 cut(s) 43
BstSCI CCNGG 1 cut(s) 272
BstXI CCANNNNNNTGG 1 cut(s) 173
BsuI GTATCC 1 cut(s) 128
BsuRI GGCC 1 cut(s) 85
BtsCI GGATG 1 cut(s) 89
Cac8I GCNNGC 1 cut(s) 17
Cfr13I GGNCC 1 cut(s) 361
CseI GACGC 1 cut(s) 56
Csp6I GTAC 1 cut(s) 43
CviAII CATG 5 cut(s) 40, 121, 131, 358, 365
CviJI RGCY 4 cut(s) 85, 171, 205, 374
CviKI_1 RGCY 4 cut(s) 85, 171, 205, 374
CviQI GTAC 1 cut(s) 43
DpnI GATC 2 cut(s) 80, 101
DpnII GATC 2 cut(s) 78, 99
Eam1104I CTCTTC 1 cut(s) 363
EarI CTCTTC 1 cut(s) 363
Eco47I GGWCC 1 cut(s) 361
EcoRII CCWGG 1 cut(s) 272
FaeI CATG 5 cut(s) 43, 124, 134, 361, 368
FatI CATG 5 cut(s) 39, 120, 130, 357, 364
FbaI TGATCA 2 cut(s) 78, 99
FokI GGATG 1 cut(s) 76
FspBI CTAG 1 cut(s) 375
HaeIII GGCC 1 cut(s) 85
HgaI GACGC 1 cut(s) 56
Hin1II CATG 5 cut(s) 43, 124, 134, 361, 368
HincII GTYRAC 1 cut(s) 160
HindII GTYRAC 1 cut(s) 160
HinfI GANTC 1 cut(s) 354
HphI GGTGA 4 cut(s) 16, 85, 307, 331
Hpy166II GTNNAC 1 cut(s) 160
Hpy188III TCNNGA 3 cut(s) 34, 288, 399
Hpy8I GTNNAC 1 cut(s) 160
HpyAV CCTTC 3 cut(s) 195, 254, 294
HpyCH4IV ACGT 1 cut(s) 58
HpyCH4V TGCA 2 cut(s) 50, 124
HpySE526I ACGT 1 cut(s) 58
Hsp92II CATG 5 cut(s) 43, 124, 134, 361, 368
Ksp22I TGATCA 2 cut(s) 78, 99
Kzo9I GATC 2 cut(s) 78, 99
LpnPI CCDG 7 cut(s) 56, 67, 159, 259, 278, 286, 336
LweI GCATC 1 cut(s) 16
MaeI CTAG 1 cut(s) 375
MaeII ACGT 1 cut(s) 58
MaeIII GTNAC 1 cut(s) 310
MalI GATC 2 cut(s) 80, 101
MboI GATC 2 cut(s) 78, 99
MboII GAAGA 3 cut(s) 380, 387, 390
MhlI GDGCHC 1 cut(s) 339
MluCI AATT 2 cut(s) 180, 319
MmeI TCCRAC 1 cut(s) 245
MnlI CCTC 2 cut(s) 240, 364
MseI TTAA 2 cut(s) 207, 249
MspR9I CCNGG 1 cut(s) 274
MvaI CCWGG 1 cut(s) 274
NdeII GATC 2 cut(s) 78, 99
NlaIII CATG 5 cut(s) 43, 124, 134, 361, 368
NmuCI GTSAC 1 cut(s) 310
NspI RCATGY 1 cut(s) 43
PcsI WCGNNNNNNNCGW 1 cut(s) 64
PfeI GAWTC 1 cut(s) 354
Psp6I CCWGG 1 cut(s) 272
PspGI CCWGG 1 cut(s) 272
PspPI GGNCC 1 cut(s) 361
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SaqAI TTAA 2 cut(s) 207, 249
Sau3AI GATC 2 cut(s) 78, 99
Sau96I GGNCC 1 cut(s) 361
ScrFI CCNGG 1 cut(s) 274
SduI GDGCHC 1 cut(s) 339
SetI ASST 7 cut(s) 61, 75, 173, 265, 278, 297, 317
SfaNI GCATC 1 cut(s) 16
SinI GGWCC 1 cut(s) 361
SmlI CTYRAG 1 cut(s) 32
SmoI CTYRAG 1 cut(s) 32
Sse9I AATT 2 cut(s) 180, 319
SspMI CTAG 1 cut(s) 375
StyD4I CCNGG 1 cut(s) 272
TaiI ACGT 1 cut(s) 61
TaqI TCGA 3 cut(s) 150, 189, 398
TasI AATT 2 cut(s) 180, 319
TatI WGTACW 1 cut(s) 42
TfiI GAWTC 1 cut(s) 354
Tru1I TTAA 2 cut(s) 207, 249
Tru9I TTAA 2 cut(s) 207, 249
TseFI GTSAC 1 cut(s) 310
Tsp45I GTSAC 1 cut(s) 310
TspDTI ATGAA 1 cut(s) 381
TspGWI ACGGA 1 cut(s) 427
VpaK11BI GGWCC 1 cut(s) 361
XapI RAATTY 1 cut(s) 319
XceI RCATGY 1 cut(s) 43
XspI CTAG 1 cut(s) 375
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.