Rw2G029840

ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
Physical Location & Seq
Forward (+)
48417481 .. 48418237
757 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G029840.1

Sequence Viewer

Length: 318 bp
ATGATCAGGCCTTCGTCCAAGGTCATCATCAGGTTCCTTATCGTTATGCAGAAGCACGGTTATATTGGAGAGTTTGAGTATGTTGATGACCACAGATCTGGAAAGATTGTGGTTGAACTTAATGGGAGGCTGAACAAGTGTGGGGTTATCAGTCCTCGCTTTGATGTTGGTGTCAAGGAGATTGAAGGCTGGACGGCTAGACTTCTTCCGTCAAGACAGTTTGGATACATTGTGTTGACAACATCTGCTGGAATCATGGATCACGAGGAAGCTAGGAGAAAGAATGTTGGTGGCAAGGTTCTCGGTTTCTTTTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.94

Weight (kDa)

9.61

Isoelectric Point (pI)

35.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S8 PF00410 4 - 105 9.1e-16 Ribosomal protein S8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 267
AgsI TTSAA 2 cut(s) 116, 185
AluBI AGCT 1 cut(s) 272
AluI AGCT 1 cut(s) 272
AlwI GGATC 1 cut(s) 267
AoxI GGCC 1 cut(s) 8
BauI CACGAG 1 cut(s) 263
BceAI ACGGC 1 cut(s) 210
BcgI CGANNNNNNTGC 2 cut(s) 283, 317
BciVI GTATCC 1 cut(s) 218
BclI TGATCA 1 cut(s) 3
BfaI CTAG 2 cut(s) 198, 273
BfuI GTATCC 1 cut(s) 218
BglII AGATCT 1 cut(s) 95
BmiI GGNNCC 1 cut(s) 35
BsaJI CCNNGG 1 cut(s) 18
BseDI CCNNGG 1 cut(s) 18
BshFI GGCC 1 cut(s) 10
BsnI GGCC 1 cut(s) 10
Bsp143I GATC 3 cut(s) 3, 95, 259
BspANI GGCC 1 cut(s) 10
BspLI GGNNCC 1 cut(s) 35
BspPI GGATC 1 cut(s) 267
BssECI CCNNGG 1 cut(s) 18
BssMI GATC 3 cut(s) 3, 95, 259
BssSI CACGAG 1 cut(s) 263
BssT1I CCWWGG 1 cut(s) 18
Bst2BI CACGAG 1 cut(s) 263
Bst4CI ACNGT 2 cut(s) 59, 219
BstKTI GATC 3 cut(s) 6, 98, 262
BstMBI GATC 3 cut(s) 3, 95, 259
BstX2I RGATCY 1 cut(s) 95
BstXI CCANNNNNNTGG 1 cut(s) 98
BstYI RGATCY 1 cut(s) 95
BsuI GTATCC 1 cut(s) 218
BsuRI GGCC 1 cut(s) 10
CviAII CATG 1 cut(s) 256
CviJI RGCY 5 cut(s) 10, 130, 189, 197, 272
CviKI_1 RGCY 5 cut(s) 10, 130, 189, 197, 272
DpnI GATC 3 cut(s) 5, 97, 261
DpnII GATC 3 cut(s) 3, 95, 259
Eco130I CCWWGG 1 cut(s) 18
Eco147I AGGCCT 1 cut(s) 10
EcoT14I CCWWGG 1 cut(s) 18
ErhI CCWWGG 1 cut(s) 18
FaeI CATG 1 cut(s) 259
FaiI YATR 4 cut(s) 47, 63, 81, 257
FatI CATG 1 cut(s) 255
FbaI TGATCA 1 cut(s) 3
FspBI CTAG 2 cut(s) 198, 273
HaeIII GGCC 1 cut(s) 10
Hin1II CATG 1 cut(s) 259
HincII GTYRAC 1 cut(s) 237
HindII GTYRAC 1 cut(s) 237
HinfI GANTC 1 cut(s) 252
Hpy166II GTNNAC 1 cut(s) 237
Hpy188III TCNNGA 3 cut(s) 99, 213, 263
Hpy8I GTNNAC 1 cut(s) 237
HpyAV CCTTC 2 cut(s) 21, 179
HpyCH4III ACNGT 2 cut(s) 59, 219
HpyCH4V TGCA 1 cut(s) 49
Hsp92II CATG 1 cut(s) 259
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 3 cut(s) 3, 95, 259
LpnPI CCDG 4 cut(s) 16, 84, 175, 234
MaeI CTAG 2 cut(s) 198, 273
MalI GATC 3 cut(s) 5, 97, 261
MboI GATC 3 cut(s) 3, 95, 259
MboII GAAGA 1 cut(s) 197
MflI RGATCY 1 cut(s) 95
MnlI CCTC 3 cut(s) 120, 165, 259
MseI TTAA 1 cut(s) 120
NdeII GATC 3 cut(s) 3, 95, 259
NlaIII CATG 1 cut(s) 259
NlaIV GGNNCC 1 cut(s) 35
PceI AGGCCT 1 cut(s) 10
PfeI GAWTC 1 cut(s) 252
PspN4I GGNNCC 1 cut(s) 35
PsuI RGATCY 1 cut(s) 95
SaqAI TTAA 1 cut(s) 120
Sau3AI GATC 3 cut(s) 3, 95, 259
SetI ASST 4 cut(s) 24, 35, 274, 300
SseBI AGGCCT 1 cut(s) 10
SspMI CTAG 2 cut(s) 198, 273
StuI AGGCCT 1 cut(s) 10
StyI CCWWGG 1 cut(s) 18
TaaI ACNGT 2 cut(s) 59, 219
TfiI GAWTC 1 cut(s) 252
Tru1I TTAA 1 cut(s) 120
Tru9I TTAA 1 cut(s) 120
TspGWI ACGGA 1 cut(s) 198
XspI CTAG 2 cut(s) 198, 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.