Rh3DG172800

ribosomal protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
OG0003734
Physical Location & Seq
Forward (+)
15190251 .. 15194436
4186 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG172800.1

Sequence Viewer

Length: 420 bp
ATGGTGAGAGTTAGCGTGCTGAATGATGCTCTCAAGAGCATGTACAATGCAGAGAAACGTGGTAAGCGTCAGGTGATGATCAGGCCGTCATCCAAAGTGATCATCAAGTTTCTTATTGTCATGCAAAAGCATGGATACATTGGAGGGTTCGAGTATGTTGACGACCACAGGTCTGGTAAAATTGTGGTCGAACTGAATGGAAGGCTTAACAAGTGTGGGGTCATTAGTCCTCGTTTTGATGTTGGTGTTAAGGAGATTGAAGGTTGGACTGCCAAGTTGCTTCCTTCAAGACAGTTTAGATATATCATGCTCACCACTTCTGCTGGCATCATGGACCATGAAGAGGCTAGAAGAAAGAATGTTATTTCTTTGAGATGTTCCATATTATGTTTGTATGCTATTTATTTCTCCGTTTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_S8

Protein Analysis

139

Amino Acids

15.9

Weight (kDa)

9.79

Isoelectric Point (pI)

40.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S8 PF00410 7 - 121 4.7e-15 Ribosomal protein S8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 343
AgsI TTSAA 2 cut(s) 260, 288
AhdI GACNNNNNGTC 1 cut(s) 169
AoxI GGCC 1 cut(s) 83
AspS9I GGNCC 1 cut(s) 334
AsuHPI GGTGA 3 cut(s) 16, 85, 304
AvaII GGWCC 1 cut(s) 334
BceAI ACGGC 1 cut(s) 70
BciVI GTATCC 1 cut(s) 128
BclI TGATCA 2 cut(s) 78, 99
BfaI CTAG 1 cut(s) 348
BfuI GTATCC 1 cut(s) 128
Bme18I GGWCC 1 cut(s) 334
BmeRI GACNNNNNGTC 1 cut(s) 169
BmgT120I GGNCC 1 cut(s) 334
BmsI GCATC 2 cut(s) 16, 336
BpuEI CTTGAG 1 cut(s) 17
Bsc4I CCNNNNNNNGG 1 cut(s) 343
BseGI GGATG 1 cut(s) 89
BseLI CCNNNNNNNGG 1 cut(s) 343
BshFI GGCC 1 cut(s) 85
BslI CCNNNNNNNGG 1 cut(s) 343
BsnI GGCC 1 cut(s) 85
Bsp1407I TGTACA 1 cut(s) 42
Bsp143I GATC 2 cut(s) 78, 99
BspANI GGCC 1 cut(s) 85
BsrGI TGTACA 1 cut(s) 42
BssMI GATC 2 cut(s) 78, 99
Bst4CI ACNGT 1 cut(s) 294
Bst6I CTCTTC 1 cut(s) 336
BstAUI TGTACA 1 cut(s) 42
BstC8I GCNNGC 2 cut(s) 17, 325
BstF5I GGATG 1 cut(s) 89
BstKTI GATC 2 cut(s) 81, 102
BstMBI GATC 2 cut(s) 78, 99
BstNSI RCATGY 1 cut(s) 43
BstXI CCANNNNNNTGG 1 cut(s) 173
BsuI GTATCC 1 cut(s) 128
BsuRI GGCC 1 cut(s) 85
BtsCI GGATG 1 cut(s) 89
Cac8I GCNNGC 2 cut(s) 17, 325
Cfr13I GGNCC 1 cut(s) 334
CseI GACGC 1 cut(s) 56
Csp6I GTAC 1 cut(s) 43
CviAII CATG 6 cut(s) 40, 121, 131, 307, 331, 338
CviJI RGCY 3 cut(s) 85, 205, 347
CviKI_1 RGCY 3 cut(s) 85, 205, 347
CviQI GTAC 1 cut(s) 43
DpnI GATC 2 cut(s) 80, 101
DpnII GATC 2 cut(s) 78, 99
DriI GACNNNNNGTC 1 cut(s) 169
Eam1104I CTCTTC 1 cut(s) 336
Eam1105I GACNNNNNGTC 1 cut(s) 169
EarI CTCTTC 1 cut(s) 336
Eco47I GGWCC 1 cut(s) 334
FaeI CATG 6 cut(s) 43, 124, 134, 310, 334, 341
FatI CATG 6 cut(s) 39, 120, 130, 306, 330, 337
FbaI TGATCA 2 cut(s) 78, 99
FokI GGATG 1 cut(s) 76
FspBI CTAG 1 cut(s) 348
HaeIII GGCC 1 cut(s) 85
HgaI GACGC 1 cut(s) 56
Hin1II CATG 6 cut(s) 43, 124, 134, 310, 334, 341
HincII GTYRAC 1 cut(s) 160
HindII GTYRAC 1 cut(s) 160
HphI GGTGA 3 cut(s) 16, 85, 304
Hpy166II GTNNAC 1 cut(s) 160
Hpy188III TCNNGA 2 cut(s) 34, 288
Hpy8I GTNNAC 1 cut(s) 160
HpyAV CCTTC 3 cut(s) 195, 254, 294
HpyCH4III ACNGT 1 cut(s) 294
HpyCH4IV ACGT 1 cut(s) 58
HpyCH4V TGCA 2 cut(s) 50, 124
HpySE526I ACGT 1 cut(s) 58
Hsp92II CATG 6 cut(s) 43, 124, 134, 310, 334, 341
Ksp22I TGATCA 2 cut(s) 78, 99
Kzo9I GATC 2 cut(s) 78, 99
LpnPI CCDG 5 cut(s) 56, 67, 154, 159, 309
LweI GCATC 2 cut(s) 16, 336
MaeI CTAG 1 cut(s) 348
MaeII ACGT 1 cut(s) 58
MalI GATC 2 cut(s) 80, 101
MboI GATC 2 cut(s) 78, 99
MboII GAAGA 2 cut(s) 353, 363
MluCI AATT 1 cut(s) 180
MmeI TCCRAC 1 cut(s) 245
MnlI CCTC 3 cut(s) 137, 240, 337
MseI TTAA 2 cut(s) 207, 249
NdeII GATC 2 cut(s) 78, 99
NlaIII CATG 6 cut(s) 43, 124, 134, 310, 334, 341
NspI RCATGY 1 cut(s) 43
PcsI WCGNNNNNNNCGW 1 cut(s) 64
PspPI GGNCC 1 cut(s) 334
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SaqAI TTAA 2 cut(s) 207, 249
Sau3AI GATC 2 cut(s) 78, 99
Sau96I GGNCC 1 cut(s) 334
SetI ASST 4 cut(s) 61, 75, 173, 265
SfaNI GCATC 2 cut(s) 16, 336
SinI GGWCC 1 cut(s) 334
SmlI CTYRAG 1 cut(s) 32
SmoI CTYRAG 1 cut(s) 32
Sse9I AATT 1 cut(s) 180
SspMI CTAG 1 cut(s) 348
TaaI ACNGT 1 cut(s) 294
TaiI ACGT 1 cut(s) 61
TaqI TCGA 2 cut(s) 150, 189
TasI AATT 1 cut(s) 180
TatI WGTACW 1 cut(s) 42
Tru1I TTAA 2 cut(s) 207, 249
Tru9I TTAA 2 cut(s) 207, 249
TspDTI ATGAA 1 cut(s) 354
TspGWI ACGGA 1 cut(s) 400
VpaK11BI GGWCC 1 cut(s) 334
XceI RCATGY 1 cut(s) 43
XspI CTAG 1 cut(s) 348
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.