Rw2G018770

ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
Physical Location & Seq
Reverse (-)
24599627 .. 24600518
892 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G018770.1

Sequence Viewer

Length: 420 bp
ATGGTGAGAGTTAGCGTGCTAAATGATGCTCTCAAGAGCATGTACAATGCAGAGAAACGTGGTAAGCGTCAGGTGATGATCAGGCCGTCATCCAAAGTGATCATCAAGTTTCTTATTGTCATGCAAAAGCATGGATACATTGGAGAGTTCGAGTATGTTGACGACCACAGCTCTGGCAAAATTGTGGTCGAACTGAATGGAAGGCTTAAAAAGTGTGGGGTCATTAGTCCTCGTTTTGATGTTGGTGTTAAGGAGATTGAAGGTTGGACTGCCAGGTTGCTTCCTTCAAGACAGTTTGGATATATCGTGCTCACCACTTCTGCTGGAATCATGGACCATGAAGAGGCTAGAAGAAAGAATGTTATTTCTTCGAGATGTTCCATATTATGTTTGTATGCTGTTTATTTCTCCGTTTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

15.78

Weight (kDa)

9.59

Isoelectric Point (pI)

35.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S8 PF00410 7 - 121 6.4e-17 Ribosomal protein S8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 343
AgsI TTSAA 2 cut(s) 260, 288
AjnI CCWGG 1 cut(s) 272
AluBI AGCT 1 cut(s) 171
AluI AGCT 1 cut(s) 171
Alw21I GWGCWC 1 cut(s) 312
AoxI GGCC 1 cut(s) 83
ArsI GACNNNNNNTTYG 2 cut(s) 171, 203
AspS9I GGNCC 1 cut(s) 334
AsuHPI GGTGA 3 cut(s) 16, 85, 304
AvaII GGWCC 1 cut(s) 334
Bbv12I GWGCWC 1 cut(s) 312
BceAI ACGGC 1 cut(s) 70
BciT130I CCWGG 1 cut(s) 274
BciVI GTATCC 1 cut(s) 128
BclI TGATCA 2 cut(s) 78, 99
BfaI CTAG 1 cut(s) 348
BfuI GTATCC 1 cut(s) 128
Bme1390I CCNGG 1 cut(s) 274
Bme18I GGWCC 1 cut(s) 334
BmgT120I GGNCC 1 cut(s) 334
BmrFI CCNGG 1 cut(s) 274
BmsI GCATC 1 cut(s) 16
BpuEI CTTGAG 1 cut(s) 17
Bsc4I CCNNNNNNNGG 1 cut(s) 343
BseBI CCWGG 1 cut(s) 274
BseGI GGATG 1 cut(s) 89
BseLI CCNNNNNNNGG 1 cut(s) 343
BshFI GGCC 1 cut(s) 85
BsiHKAI GWGCWC 1 cut(s) 312
BslI CCNNNNNNNGG 1 cut(s) 343
BsnI GGCC 1 cut(s) 85
Bsp1286I GDGCHC 1 cut(s) 312
Bsp1407I TGTACA 1 cut(s) 42
Bsp143I GATC 2 cut(s) 78, 99
BspANI GGCC 1 cut(s) 85
BsrGI TGTACA 1 cut(s) 42
BssMI GATC 2 cut(s) 78, 99
Bst2UI CCWGG 1 cut(s) 274
Bst4CI ACNGT 1 cut(s) 294
Bst6I CTCTTC 1 cut(s) 336
BstAUI TGTACA 1 cut(s) 42
BstC8I GCNNGC 1 cut(s) 17
BstF5I GGATG 1 cut(s) 89
BstKTI GATC 2 cut(s) 81, 102
BstMBI GATC 2 cut(s) 78, 99
BstNI CCWGG 1 cut(s) 274
BstNSI RCATGY 1 cut(s) 43
BstSCI CCNGG 1 cut(s) 272
BstXI CCANNNNNNTGG 1 cut(s) 173
BsuI GTATCC 1 cut(s) 128
BsuRI GGCC 1 cut(s) 85
BtsCI GGATG 1 cut(s) 89
Cac8I GCNNGC 1 cut(s) 17
Cfr13I GGNCC 1 cut(s) 334
CseI GACGC 1 cut(s) 56
Csp6I GTAC 1 cut(s) 43
CviAII CATG 5 cut(s) 40, 121, 131, 331, 338
CviJI RGCY 4 cut(s) 85, 171, 205, 347
CviKI_1 RGCY 4 cut(s) 85, 171, 205, 347
CviQI GTAC 1 cut(s) 43
DpnI GATC 2 cut(s) 80, 101
DpnII GATC 2 cut(s) 78, 99
Eam1104I CTCTTC 1 cut(s) 336
EarI CTCTTC 1 cut(s) 336
Eco47I GGWCC 1 cut(s) 334
EcoRII CCWGG 1 cut(s) 272
FaeI CATG 5 cut(s) 43, 124, 134, 334, 341
FatI CATG 5 cut(s) 39, 120, 130, 330, 337
FbaI TGATCA 2 cut(s) 78, 99
FokI GGATG 1 cut(s) 76
FspBI CTAG 1 cut(s) 348
HaeIII GGCC 1 cut(s) 85
HgaI GACGC 1 cut(s) 56
Hin1II CATG 5 cut(s) 43, 124, 134, 334, 341
HincII GTYRAC 1 cut(s) 160
HindII GTYRAC 1 cut(s) 160
HinfI GANTC 1 cut(s) 327
HphI GGTGA 3 cut(s) 16, 85, 304
Hpy166II GTNNAC 1 cut(s) 160
Hpy188III TCNNGA 3 cut(s) 34, 288, 372
Hpy8I GTNNAC 1 cut(s) 160
HpyAV CCTTC 3 cut(s) 195, 254, 294
HpyCH4III ACNGT 1 cut(s) 294
HpyCH4IV ACGT 1 cut(s) 58
HpyCH4V TGCA 2 cut(s) 50, 124
HpySE526I ACGT 1 cut(s) 58
Hsp92II CATG 5 cut(s) 43, 124, 134, 334, 341
Ksp22I TGATCA 2 cut(s) 78, 99
Kzo9I GATC 2 cut(s) 78, 99
LpnPI CCDG 6 cut(s) 56, 67, 159, 259, 286, 309
LweI GCATC 1 cut(s) 16
MaeI CTAG 1 cut(s) 348
MaeII ACGT 1 cut(s) 58
MalI GATC 2 cut(s) 80, 101
MboI GATC 2 cut(s) 78, 99
MboII GAAGA 3 cut(s) 353, 360, 363
MhlI GDGCHC 1 cut(s) 312
MluCI AATT 1 cut(s) 180
MmeI TCCRAC 1 cut(s) 245
MnlI CCTC 2 cut(s) 240, 337
MseI TTAA 2 cut(s) 207, 249
MspR9I CCNGG 1 cut(s) 274
MvaI CCWGG 1 cut(s) 274
NdeII GATC 2 cut(s) 78, 99
NlaIII CATG 5 cut(s) 43, 124, 134, 334, 341
NspI RCATGY 1 cut(s) 43
PcsI WCGNNNNNNNCGW 1 cut(s) 64
PfeI GAWTC 1 cut(s) 327
Psp6I CCWGG 1 cut(s) 272
PspGI CCWGG 1 cut(s) 272
PspPI GGNCC 1 cut(s) 334
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SaqAI TTAA 2 cut(s) 207, 249
Sau3AI GATC 2 cut(s) 78, 99
Sau96I GGNCC 1 cut(s) 334
ScrFI CCNGG 1 cut(s) 274
SduI GDGCHC 1 cut(s) 312
SetI ASST 5 cut(s) 61, 75, 173, 265, 278
SfaNI GCATC 1 cut(s) 16
SinI GGWCC 1 cut(s) 334
SmlI CTYRAG 1 cut(s) 32
SmoI CTYRAG 1 cut(s) 32
Sse9I AATT 1 cut(s) 180
SspMI CTAG 1 cut(s) 348
StyD4I CCNGG 1 cut(s) 272
TaaI ACNGT 1 cut(s) 294
TaiI ACGT 1 cut(s) 61
TaqI TCGA 3 cut(s) 150, 189, 371
TasI AATT 1 cut(s) 180
TatI WGTACW 1 cut(s) 42
TfiI GAWTC 1 cut(s) 327
Tru1I TTAA 2 cut(s) 207, 249
Tru9I TTAA 2 cut(s) 207, 249
TspDTI ATGAA 1 cut(s) 354
TspGWI ACGGA 1 cut(s) 400
VpaK11BI GGWCC 1 cut(s) 334
XceI RCATGY 1 cut(s) 43
XspI CTAG 1 cut(s) 348
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.