Rw0G014020

ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Contig00628
Physical Location & Seq
Forward (+)
7217 .. 8104
888 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw0G014020.1

Sequence Viewer

Length: 420 bp
ATGGTGAGAGTTAGCGTGCTGAATGATGCTCTCAAGAGCATGTACAATGCAGAGAAACGTGGTAAGCGTCAGGTGATGATCAGGCCGTCATCCAAAGTGATCATCAAGTTTCTTATTGTCATGCAAAAGCATGGATACATTGGAGAGTTCGAGTATGTTGACGACCACAGCTCTGGCAAAATTGTGGTCGAACTGAATGGAAGGCTTAAAAAGTGTGGGGTCATTAGTCCTCGTTTTGATGTTGGTGTTAAGGAGATTGAAGGTTGGACTGCCAGGTTGCTTCCTTCAAGACAGGTTATTGGATATATCGTGCTCACCACTTCTGCTGGAATCATGGACCATGAAGAGGCTAGAAGAAAGAATGTTATTTCTTCGAGATGTTCCATATGTTTGTATGCTGTTTATTTCTCCGTTTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

15.73

Weight (kDa)

9.59

Isoelectric Point (pI)

33.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S8 PF00410 7 - 122 1.7e-17 Ribosomal protein S8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 346
AgsI TTSAA 2 cut(s) 260, 288
AjnI CCWGG 1 cut(s) 272
AluBI AGCT 1 cut(s) 171
AluI AGCT 1 cut(s) 171
Alw21I GWGCWC 1 cut(s) 315
AoxI GGCC 1 cut(s) 83
ArsI GACNNNNNNTTYG 2 cut(s) 171, 203
AspS9I GGNCC 1 cut(s) 337
AsuHPI GGTGA 3 cut(s) 16, 85, 307
AvaII GGWCC 1 cut(s) 337
Bbv12I GWGCWC 1 cut(s) 315
BceAI ACGGC 1 cut(s) 70
BciT130I CCWGG 1 cut(s) 274
BciVI GTATCC 1 cut(s) 128
BclI TGATCA 2 cut(s) 78, 99
BfaI CTAG 1 cut(s) 351
BfuI GTATCC 1 cut(s) 128
Bme1390I CCNGG 1 cut(s) 274
Bme18I GGWCC 1 cut(s) 337
BmgT120I GGNCC 1 cut(s) 337
BmrFI CCNGG 1 cut(s) 274
BmsI GCATC 1 cut(s) 16
BpuEI CTTGAG 1 cut(s) 17
Bsc4I CCNNNNNNNGG 1 cut(s) 346
BseBI CCWGG 1 cut(s) 274
BseGI GGATG 1 cut(s) 89
BseLI CCNNNNNNNGG 1 cut(s) 346
BshFI GGCC 1 cut(s) 85
BsiHKAI GWGCWC 1 cut(s) 315
BslI CCNNNNNNNGG 1 cut(s) 346
BsnI GGCC 1 cut(s) 85
Bsp1286I GDGCHC 1 cut(s) 315
Bsp1407I TGTACA 1 cut(s) 42
Bsp143I GATC 2 cut(s) 78, 99
BspANI GGCC 1 cut(s) 85
BsrGI TGTACA 1 cut(s) 42
BssMI GATC 2 cut(s) 78, 99
Bst2UI CCWGG 1 cut(s) 274
Bst6I CTCTTC 1 cut(s) 339
BstAUI TGTACA 1 cut(s) 42
BstC8I GCNNGC 1 cut(s) 17
BstF5I GGATG 1 cut(s) 89
BstKTI GATC 2 cut(s) 81, 102
BstMBI GATC 2 cut(s) 78, 99
BstNI CCWGG 1 cut(s) 274
BstNSI RCATGY 1 cut(s) 43
BstSCI CCNGG 1 cut(s) 272
BstXI CCANNNNNNTGG 1 cut(s) 173
BsuI GTATCC 1 cut(s) 128
BsuRI GGCC 1 cut(s) 85
BtsCI GGATG 1 cut(s) 89
Cac8I GCNNGC 1 cut(s) 17
Cfr13I GGNCC 1 cut(s) 337
CseI GACGC 1 cut(s) 56
Csp6I GTAC 1 cut(s) 43
CviAII CATG 5 cut(s) 40, 121, 131, 334, 341
CviJI RGCY 4 cut(s) 85, 171, 205, 350
CviKI_1 RGCY 4 cut(s) 85, 171, 205, 350
CviQI GTAC 1 cut(s) 43
DpnI GATC 2 cut(s) 80, 101
DpnII GATC 2 cut(s) 78, 99
Eam1104I CTCTTC 1 cut(s) 339
EarI CTCTTC 1 cut(s) 339
Eco47I GGWCC 1 cut(s) 337
EcoRII CCWGG 1 cut(s) 272
FaeI CATG 5 cut(s) 43, 124, 134, 337, 344
FatI CATG 5 cut(s) 39, 120, 130, 333, 340
FauNDI CATATG 1 cut(s) 386
FbaI TGATCA 2 cut(s) 78, 99
FokI GGATG 1 cut(s) 76
FspBI CTAG 1 cut(s) 351
HaeIII GGCC 1 cut(s) 85
HgaI GACGC 1 cut(s) 56
Hin1II CATG 5 cut(s) 43, 124, 134, 337, 344
HincII GTYRAC 1 cut(s) 160
HindII GTYRAC 1 cut(s) 160
HinfI GANTC 1 cut(s) 330
HphI GGTGA 3 cut(s) 16, 85, 307
Hpy166II GTNNAC 1 cut(s) 160
Hpy188III TCNNGA 3 cut(s) 34, 288, 375
Hpy8I GTNNAC 1 cut(s) 160
HpyAV CCTTC 3 cut(s) 195, 254, 294
HpyCH4IV ACGT 1 cut(s) 58
HpyCH4V TGCA 2 cut(s) 50, 124
HpySE526I ACGT 1 cut(s) 58
Hsp92II CATG 5 cut(s) 43, 124, 134, 337, 344
Ksp22I TGATCA 2 cut(s) 78, 99
Kzo9I GATC 2 cut(s) 78, 99
LpnPI CCDG 7 cut(s) 56, 67, 159, 259, 278, 286, 312
LweI GCATC 1 cut(s) 16
MaeI CTAG 1 cut(s) 351
MaeII ACGT 1 cut(s) 58
MalI GATC 2 cut(s) 80, 101
MboI GATC 2 cut(s) 78, 99
MboII GAAGA 3 cut(s) 356, 363, 366
MhlI GDGCHC 1 cut(s) 315
MluCI AATT 1 cut(s) 180
MmeI TCCRAC 1 cut(s) 245
MnlI CCTC 2 cut(s) 240, 340
MseI TTAA 2 cut(s) 207, 249
MspR9I CCNGG 1 cut(s) 274
MvaI CCWGG 1 cut(s) 274
NdeI CATATG 1 cut(s) 386
NdeII GATC 2 cut(s) 78, 99
NlaIII CATG 5 cut(s) 43, 124, 134, 337, 344
NspI RCATGY 1 cut(s) 43
PcsI WCGNNNNNNNCGW 1 cut(s) 64
PfeI GAWTC 1 cut(s) 330
Psp6I CCWGG 1 cut(s) 272
PspGI CCWGG 1 cut(s) 272
PspPI GGNCC 1 cut(s) 337
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SaqAI TTAA 2 cut(s) 207, 249
Sau3AI GATC 2 cut(s) 78, 99
Sau96I GGNCC 1 cut(s) 337
ScrFI CCNGG 1 cut(s) 274
SduI GDGCHC 1 cut(s) 315
SetI ASST 6 cut(s) 61, 75, 173, 265, 278, 297
SfaNI GCATC 1 cut(s) 16
SinI GGWCC 1 cut(s) 337
SmlI CTYRAG 1 cut(s) 32
SmoI CTYRAG 1 cut(s) 32
Sse9I AATT 1 cut(s) 180
SspMI CTAG 1 cut(s) 351
StyD4I CCNGG 1 cut(s) 272
TaiI ACGT 1 cut(s) 61
TaqI TCGA 3 cut(s) 150, 189, 374
TasI AATT 1 cut(s) 180
TatI WGTACW 1 cut(s) 42
TfiI GAWTC 1 cut(s) 330
Tru1I TTAA 2 cut(s) 207, 249
Tru9I TTAA 2 cut(s) 207, 249
TspDTI ATGAA 1 cut(s) 357
TspGWI ACGGA 1 cut(s) 400
VpaK11BI GGWCC 1 cut(s) 337
XceI RCATGY 1 cut(s) 43
XspI CTAG 1 cut(s) 351
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.