Rmu_sc0002438.1_g000009

Belongs to the universal ribosomal protein uS8 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002438.1
Physical Location & Seq
Reverse (-)
32010 .. 33451
1442 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002438.1_g000009.1.cds

Sequence Viewer

Length: 612 bp
atgggtgttggtggttgctgtaaaaagatagttggactggcgggttgttatgtgaatatggatgaagttaggaacttagcatgtgcttttatggttttggcagcgacaatggtgagagttagcgtgctgaatgatgctctcaagagcatgtacagtgcagagaaacacggtaagcgtcaggtgatgatcaggccgtcatccaaagtgatcatcaagtttcttattgtcatgcaaaagcatggatacattggagagttcgagtatgttgacgaccacaggtctggtaaaattgtggtcgaactgaatggaaggcttaacaagtgtggggtcattagtcctcgttttgatgttggtgtgaaggagattgaaggttggactgccaggttacttccttcaagacagtttggatatattgtgctcaccacttctgctggcatcatagaccatgaagaggctagaagaaagaatattgtcaggcagtggttccaacctgtagaggcttcaaggttgagaagtaaaatctggaagttactcaaggaagaatttcaaaatgcatccaagtctaactgctctaaagaatcttctcctttgagcgatgcttctgatgaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

203

Amino Acids

22.79

Weight (kDa)

9.33

Isoelectric Point (pI)

38.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 41
AcsI RAATTY 1 cut(s) 542
AfaI GTAC 1 cut(s) 152
AfiI CCNNNNNNNGG 1 cut(s) 451
AgsI TTSAA 4 cut(s) 368, 396, 504, 548
AhdI GACNNNNNGTC 1 cut(s) 277
AjnI CCWGG 1 cut(s) 380
Alw21I GWGCWC 1 cut(s) 420
AoxI GGCC 1 cut(s) 191
ApeKI GCWGC 1 cut(s) 101
ApoI RAATTY 1 cut(s) 542
Asp700I GAANNNNTTC 1 cut(s) 543
AsuHPI GGTGA 3 cut(s) 124, 193, 412
Bbv12I GWGCWC 1 cut(s) 420
BbvI GCAGC 1 cut(s) 113
BceAI ACGGC 1 cut(s) 178
BciT130I CCWGG 1 cut(s) 382
BciVI GTATCC 1 cut(s) 236
BclI TGATCA 2 cut(s) 186, 207
BfaI CTAG 1 cut(s) 456
BfmI CTRYAG 1 cut(s) 492
BfuI GTATCC 1 cut(s) 236
BisI GCNGC 1 cut(s) 102
BlsI GCNGC 1 cut(s) 103
Bme1390I CCNGG 1 cut(s) 382
BmeRI GACNNNNNGTC 1 cut(s) 277
BmiI GGNNCC 1 cut(s) 485
BmrFI CCNGG 1 cut(s) 382
BmsI GCATC 4 cut(s) 124, 444, 563, 586
BpuEI CTTGAG 2 cut(s) 125, 518
Bsc4I CCNNNNNNNGG 1 cut(s) 451
Bse1I ACTGG 1 cut(s) 42
BseBI CCWGG 1 cut(s) 382
BseGI GGATG 3 cut(s) 67, 197, 554
BseLI CCNNNNNNNGG 1 cut(s) 451
BseNI ACTGG 1 cut(s) 42
BseXI GCAGC 1 cut(s) 113
BsgI GTGCAG 1 cut(s) 177
BshFI GGCC 1 cut(s) 193
BsiHKAI GWGCWC 1 cut(s) 420
BslI CCNNNNNNNGG 1 cut(s) 451
BsnI GGCC 1 cut(s) 193
Bsp1286I GDGCHC 1 cut(s) 420
Bsp1407I TGTACA 1 cut(s) 150
Bsp143I GATC 2 cut(s) 186, 207
BspACI CCGC 1 cut(s) 41
BspANI GGCC 1 cut(s) 193
BspLI GGNNCC 1 cut(s) 485
BsrGI TGTACA 1 cut(s) 150
BsrI ACTGG 1 cut(s) 42
BssMI GATC 2 cut(s) 186, 207
Bst2UI CCWGG 1 cut(s) 382
Bst4CI ACNGT 3 cut(s) 155, 170, 402
Bst6I CTCTTC 1 cut(s) 444
BstAUI TGTACA 1 cut(s) 150
BstC8I GCNNGC 2 cut(s) 125, 433
BstDEI CTNAG 1 cut(s) 76
BstF5I GGATG 3 cut(s) 67, 197, 554
BstKTI GATC 2 cut(s) 189, 210
BstMBI GATC 2 cut(s) 186, 207
BstNI CCWGG 1 cut(s) 382
BstNSI RCATGY 2 cut(s) 84, 151
BstSCI CCNGG 1 cut(s) 380
BstSFI CTRYAG 1 cut(s) 492
BstV1I GCAGC 1 cut(s) 113
BstXI CCANNNNNNTGG 1 cut(s) 281
BsuI GTATCC 1 cut(s) 236
BsuRI GGCC 1 cut(s) 193
BtsCI GGATG 3 cut(s) 67, 197, 554
BtsI GCAGTG 1 cut(s) 485
BtsIMutI CAGTG 2 cut(s) 160, 485
Cac8I GCNNGC 2 cut(s) 125, 433
CseI GACGC 1 cut(s) 164
Csp6I GTAC 1 cut(s) 151
CviAII CATG 5 cut(s) 81, 148, 229, 239, 446
CviJI RGCY 4 cut(s) 193, 313, 455, 500
CviKI_1 RGCY 4 cut(s) 193, 313, 455, 500
CviQI GTAC 1 cut(s) 151
DdeI CTNAG 1 cut(s) 76
DpnI GATC 2 cut(s) 188, 209
DpnII GATC 2 cut(s) 186, 207
DriI GACNNNNNGTC 1 cut(s) 277
Eam1104I CTCTTC 1 cut(s) 444
Eam1105I GACNNNNNGTC 1 cut(s) 277
EarI CTCTTC 1 cut(s) 444
EcoRII CCWGG 1 cut(s) 380
EcoT22I ATGCAT 1 cut(s) 556
FaeI CATG 5 cut(s) 84, 151, 232, 242, 449
FatI CATG 5 cut(s) 80, 147, 228, 238, 445
FauI CCCGC 1 cut(s) 34
FbaI TGATCA 2 cut(s) 186, 207
Fnu4HI GCNGC 1 cut(s) 102
FokI GGATG 3 cut(s) 74, 184, 541
Fsp4HI GCNGC 1 cut(s) 102
FspBI CTAG 1 cut(s) 456
GluI GCNGC 1 cut(s) 102
HaeIII GGCC 1 cut(s) 193
HgaI GACGC 1 cut(s) 164
Hin1II CATG 5 cut(s) 84, 151, 232, 242, 449
HincII GTYRAC 1 cut(s) 268
HindII GTYRAC 1 cut(s) 268
HinfI GANTC 1 cut(s) 578
HphI GGTGA 3 cut(s) 124, 193, 412
Hpy166II GTNNAC 1 cut(s) 268
Hpy188I TCNGA 1 cut(s) 604
Hpy188III TCNNGA 3 cut(s) 142, 396, 523
Hpy8I GTNNAC 1 cut(s) 268
HpyAV CCTTC 4 cut(s) 303, 352, 362, 402
HpyCH4III ACNGT 3 cut(s) 155, 170, 402
HpyCH4V TGCA 3 cut(s) 158, 232, 554
HpyF3I CTNAG 1 cut(s) 76
Hsp92II CATG 5 cut(s) 84, 151, 232, 242, 449
Ksp22I TGATCA 2 cut(s) 186, 207
Kzo9I GATC 2 cut(s) 186, 207
Lsp1109I GCAGC 1 cut(s) 113
LweI GCATC 4 cut(s) 124, 444, 563, 586
MaeI CTAG 1 cut(s) 456
MaeIII GTNAC 2 cut(s) 384, 528
MalI GATC 2 cut(s) 188, 209
MboI GATC 2 cut(s) 186, 207
MboII GAAGA 4 cut(s) 461, 471, 551, 573
MhlI GDGCHC 1 cut(s) 420
MluCI AATT 2 cut(s) 288, 542
MmeI TCCRAC 3 cut(s) 13, 353, 511
MnlI CCTC 3 cut(s) 348, 445, 490
Mph1103I ATGCAT 1 cut(s) 556
MroXI GAANNNNTTC 1 cut(s) 543
MseI TTAA 1 cut(s) 315
MspR9I CCNGG 1 cut(s) 382
MvaI CCWGG 1 cut(s) 382
NdeII GATC 2 cut(s) 186, 207
NlaIII CATG 5 cut(s) 84, 151, 232, 242, 449
NlaIV GGNNCC 1 cut(s) 485
NsiI ATGCAT 1 cut(s) 556
NspI RCATGY 2 cut(s) 84, 151
PdmI GAANNNNTTC 1 cut(s) 543
PfeI GAWTC 1 cut(s) 578
PkrI GCNGC 1 cut(s) 103
Psp6I CCWGG 1 cut(s) 380
PspGI CCWGG 1 cut(s) 380
PspN4I GGNNCC 1 cut(s) 485
RsaI GTAC 1 cut(s) 152
RsaNI GTAC 1 cut(s) 151
SaqAI TTAA 1 cut(s) 315
SatI GCNGC 1 cut(s) 102
Sau3AI GATC 2 cut(s) 186, 207
ScrFI CCNGG 1 cut(s) 382
SduI GDGCHC 1 cut(s) 420
SetI ASST 6 cut(s) 183, 281, 373, 386, 493, 509
SfaNI GCATC 4 cut(s) 124, 444, 563, 586
SfcI CTRYAG 1 cut(s) 492
SmlI CTYRAG 2 cut(s) 140, 533
SmoI CTYRAG 2 cut(s) 140, 533
Sse9I AATT 2 cut(s) 288, 542
SsiI CCGC 1 cut(s) 41
SspI AATATT 1 cut(s) 469
SspMI CTAG 1 cut(s) 456
StyD4I CCNGG 1 cut(s) 380
TaaI ACNGT 3 cut(s) 155, 170, 402
TaqI TCGA 2 cut(s) 258, 297
TasI AATT 2 cut(s) 288, 542
TatI WGTACW 1 cut(s) 150
TfiI GAWTC 1 cut(s) 578
Tru1I TTAA 1 cut(s) 315
Tru9I TTAA 1 cut(s) 315
TscAI CASTG 2 cut(s) 160, 485
TseI GCWGC 1 cut(s) 101
TspDTI ATGAA 2 cut(s) 78, 462
TspRI CASTG 2 cut(s) 160, 485
XapI RAATTY 1 cut(s) 542
XceI RCATGY 2 cut(s) 84, 151
XmnI GAANNNNTTC 1 cut(s) 543
XspI CTAG 1 cut(s) 456
Zsp2I ATGCAT 1 cut(s) 556
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.