Rmu_co8193382.1_g000001

Xylose isomerase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8193382.1
Physical Location & Seq
Forward (+)
1 .. 366
366 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8193382.1_g000001.1.cds

Sequence Viewer

Length: 173 bp
tgaaagccaactttgagttcataaataagcttggagtcgataggtggtgtttccatgacagggatattgctccggatggcaaaaccttggaggaaactaataaaaacttggatgaggtggtggcccttgccaaggagcttcaggtaagtttgtacaagtacaccatgaaataa

Protein Analysis

56

Amino Acids

6.55

Weight (kDa)

5.72

Isoelectric Point (pI)

25.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 72
AcuI CTGAAG 1 cut(s) 124
AfaI GTAC 2 cut(s) 154, 160
AfiI CCNNNNNNNGG 2 cut(s) 60, 132
AjuI GAANNNNNNNTTGG 1 cut(s) 33
AluBI AGCT 2 cut(s) 30, 138
AluI AGCT 2 cut(s) 30, 138
Aor13HI TCCGGA 1 cut(s) 72
AoxI GGCC 1 cut(s) 122
AspS9I GGNCC 1 cut(s) 123
BccI CCATC 1 cut(s) 70
BmgT120I GGNCC 1 cut(s) 123
BsaJI CCNNGG 2 cut(s) 86, 131
BsaWI WCCGGW 1 cut(s) 72
Bsc4I CCNNNNNNNGG 2 cut(s) 60, 132
BseAI TCCGGA 1 cut(s) 72
BseDI CCNNGG 2 cut(s) 86, 131
BseGI GGATG 2 cut(s) 81, 117
BseLI CCNNNNNNNGG 2 cut(s) 60, 132
BshFI GGCC 1 cut(s) 124
BsiSI CCGG 1 cut(s) 73
BslI CCNNNNNNNGG 2 cut(s) 60, 132
BsnI GGCC 1 cut(s) 124
Bsp13I TCCGGA 1 cut(s) 72
Bsp1407I TGTACA 1 cut(s) 152
BspANI GGCC 1 cut(s) 124
BspEI TCCGGA 1 cut(s) 72
BsrGI TGTACA 1 cut(s) 152
BssECI CCNNGG 2 cut(s) 86, 131
BssT1I CCWWGG 2 cut(s) 86, 131
BstAUI TGTACA 1 cut(s) 152
BstENI CCTNNNNNAGG 1 cut(s) 130
BstF5I GGATG 2 cut(s) 81, 117
BsuRI GGCC 1 cut(s) 124
BtsCI GGATG 2 cut(s) 81, 117
Cfr13I GGNCC 1 cut(s) 123
Csp6I GTAC 2 cut(s) 153, 159
CviAII CATG 2 cut(s) 55, 165
CviJI RGCY 4 cut(s) 7, 30, 124, 138
CviKI_1 RGCY 4 cut(s) 7, 30, 124, 138
CviQI GTAC 2 cut(s) 153, 159
Eco130I CCWWGG 2 cut(s) 86, 131
Eco57I CTGAAG 1 cut(s) 124
EcoNI CCTNNNNNAGG 1 cut(s) 130
EcoT14I CCWWGG 2 cut(s) 86, 131
ErhI CCWWGG 2 cut(s) 86, 131
FaeI CATG 2 cut(s) 58, 168
FaiI YATR 3 cut(s) 22, 56, 166
FatI CATG 2 cut(s) 54, 164
FokI GGATG 2 cut(s) 88, 124
HaeIII GGCC 1 cut(s) 124
HapII CCGG 1 cut(s) 73
Hin1II CATG 2 cut(s) 58, 168
HindIII AAGCTT 1 cut(s) 28
HinfI GANTC 1 cut(s) 35
HpaII CCGG 1 cut(s) 73
Hpy166II GTNNAC 1 cut(s) 161
Hpy188III TCNNGA 1 cut(s) 73
Hpy8I GTNNAC 1 cut(s) 161
Hsp92II CATG 2 cut(s) 58, 168
Kpn2I TCCGGA 1 cut(s) 72
LmnI GCTCC 2 cut(s) 75, 135
LpnPI CCDG 3 cut(s) 45, 86, 127
MlyI GAGTC 1 cut(s) 44
MnlI CCTC 2 cut(s) 84, 108
MroI TCCGGA 1 cut(s) 72
MspI CCGG 1 cut(s) 73
NlaIII CATG 2 cut(s) 58, 168
PleI GAGTC 1 cut(s) 43
PpsI GAGTC 1 cut(s) 43
PspPI GGNCC 1 cut(s) 123
RsaI GTAC 2 cut(s) 154, 160
RsaNI GTAC 2 cut(s) 153, 159
Sau96I GGNCC 1 cut(s) 123
SchI GAGTC 1 cut(s) 44
SetI ASST 6 cut(s) 32, 46, 88, 119, 140, 146
StyI CCWWGG 2 cut(s) 86, 131
TaqI TCGA 1 cut(s) 38
TatI WGTACW 2 cut(s) 152, 158
TspDTI ATGAA 1 cut(s) 9
XagI CCTNNNNNAGG 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.