Rh6AG078400

Kynurenine formamidase-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
11399419 .. 11402745
3327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG078400.1

Sequence Viewer

Length: 222 bp
ATGAGACACTGTATGAGAGGATACAAAGAGCCAGGTCCAGCATTGTTAGTTGATGTTCCGAGGGACAAGAACATAACTGCTGAAGTGATGAAGTCCTTAAATATTCCAAAGGGAGTACGTCGTGTGCTCTTTAGAACATTAAATACTGACAGGAAACAGCAACAGCCCCAGGAAAAATTGCATCGCATGTCTGAGTTCTTGCAAGGAATGGAAAAGATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.61

Weight (kDa)

10.21

Isoelectric Point (pI)

65.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 102
AfaI GTAC 1 cut(s) 117
AjnI CCWGG 2 cut(s) 31, 168
Alw21I GWGCWC 1 cut(s) 129
AspS9I GGNCC 1 cut(s) 35
AvaII GGWCC 1 cut(s) 35
Bbv12I GWGCWC 1 cut(s) 129
BciT130I CCWGG 2 cut(s) 33, 170
BciVI GTATCC 1 cut(s) 14
BfuI GTATCC 1 cut(s) 14
Bme1390I CCNGG 2 cut(s) 33, 170
Bme18I GGWCC 1 cut(s) 35
BmgT120I GGNCC 1 cut(s) 35
BmrFI CCNGG 2 cut(s) 33, 170
BmsI GCATC 1 cut(s) 190
BsaJI CCNNGG 2 cut(s) 59, 168
BseBI CCWGG 2 cut(s) 33, 170
BseDI CCNNGG 2 cut(s) 59, 168
BseMII CTCAG 1 cut(s) 183
BsiHKAI GWGCWC 1 cut(s) 129
BslFI GGGAC 1 cut(s) 77
BsmFI GGGAC 1 cut(s) 77
Bsp1286I GDGCHC 1 cut(s) 129
BspCNI CTCAG 1 cut(s) 184
BssECI CCNNGG 2 cut(s) 59, 168
Bst2UI CCWGG 2 cut(s) 33, 170
Bst4CI ACNGT 1 cut(s) 11
BstDEI CTNAG 1 cut(s) 192
BstNI CCWGG 2 cut(s) 33, 170
BstNSI RCATGY 1 cut(s) 190
BstSCI CCNGG 2 cut(s) 31, 168
BsuI GTATCC 1 cut(s) 14
BtgZI GCGATG 1 cut(s) 167
BtsIMutI CAGTG 1 cut(s) 7
Cfr13I GGNCC 1 cut(s) 35
Csp6I GTAC 1 cut(s) 116
CviAII CATG 1 cut(s) 187
CviJI RGCY 2 cut(s) 31, 166
CviKI_1 RGCY 2 cut(s) 31, 166
CviQI GTAC 1 cut(s) 116
DdeI CTNAG 1 cut(s) 192
Eco47I GGWCC 1 cut(s) 35
Eco57I CTGAAG 1 cut(s) 102
EcoRII CCWGG 2 cut(s) 31, 168
FaeI CATG 1 cut(s) 190
FaiI YATR 3 cut(s) 14, 74, 188
FaqI GGGAC 1 cut(s) 77
FatI CATG 1 cut(s) 186
Hin1II CATG 1 cut(s) 190
Hpy188I TCNGA 2 cut(s) 60, 193
Hpy99I CGWCG 1 cut(s) 123
HpyCH4III ACNGT 1 cut(s) 11
HpyCH4IV ACGT 1 cut(s) 118
HpyCH4V TGCA 2 cut(s) 181, 202
HpyF3I CTNAG 1 cut(s) 192
HpySE526I ACGT 1 cut(s) 118
Hsp92II CATG 1 cut(s) 190
LpnPI CCDG 6 cut(s) 18, 45, 51, 136, 155, 182
LweI GCATC 1 cut(s) 190
MaeII ACGT 1 cut(s) 118
MhlI GDGCHC 1 cut(s) 129
MluCI AATT 1 cut(s) 176
MnlI CCTC 2 cut(s) 11, 54
MseI TTAA 2 cut(s) 98, 140
MspR9I CCNGG 2 cut(s) 33, 170
MvaI CCWGG 2 cut(s) 33, 170
NlaIII CATG 1 cut(s) 190
NspI RCATGY 1 cut(s) 190
Psp6I CCWGG 2 cut(s) 31, 168
PspGI CCWGG 2 cut(s) 31, 168
PspPI GGNCC 1 cut(s) 35
PsrI GAACNNNNNNTAC 2 cut(s) 127, 159
RsaI GTAC 1 cut(s) 117
RsaNI GTAC 1 cut(s) 116
SaqAI TTAA 2 cut(s) 98, 140
Sau96I GGNCC 1 cut(s) 35
ScrFI CCNGG 2 cut(s) 33, 170
SduI GDGCHC 1 cut(s) 129
SetI ASST 2 cut(s) 37, 121
SfaNI GCATC 1 cut(s) 190
SinI GGWCC 1 cut(s) 35
Sse9I AATT 1 cut(s) 176
SspI AATATT 1 cut(s) 103
StyD4I CCNGG 2 cut(s) 31, 168
TaaI ACNGT 1 cut(s) 11
TaiI ACGT 1 cut(s) 121
TasI AATT 1 cut(s) 176
Tru1I TTAA 2 cut(s) 98, 140
Tru9I TTAA 2 cut(s) 98, 140
TscAI CASTG 1 cut(s) 14
TspDTI ATGAA 1 cut(s) 104
TspRI CASTG 1 cut(s) 14
VpaK11BI GGWCC 1 cut(s) 35
XceI RCATGY 1 cut(s) 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.