Rmu_co8199800.1_g000001

Hydrolyzes acetyl esters in homogalacturonan regions of pectin. In type I primary cell wall, galacturonic acid residues of pectin can be acetylated at the O-2 and O-3 positions. Decreasing the degree of acetylation of pectin gels in vitro alters their physical properties

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8199800.1
Physical Location & Seq
Reverse (-)
1 .. 654
654 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8199800.1_g000001.1.cds

Sequence Viewer

Length: 276 bp
atgtcttgtatttgttttcttcagctccaagctagtttagcccctccatctgctgatcctaatggtttatggaatgaatgcaaatcaaaccatgcaaattgtaatttatcccagatccagtttctccaagatttcaggaatcaaatgctcagtgctgtgaaagatttctcaatgtcccgtgaaaatggtttattcataaactcttgctttgctcactgccagtctgagagacaagatacatggtttgctgatgattctcctgttcttgaaaaccag

Protein Analysis

92

Amino Acids

10.43

Weight (kDa)

4.59

Isoelectric Point (pI)

64.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 50, 109
AcuI CTGAAG 1 cut(s) 5
AgsI TTSAA 1 cut(s) 269
AluBI AGCT 2 cut(s) 25, 32
AluI AGCT 2 cut(s) 25, 32
Alw26I GTCTC 1 cut(s) 223
AlwI GGATC 2 cut(s) 50, 109
Asp700I GAANNNNTTC 1 cut(s) 164
BccI CCATC 1 cut(s) 55
BcoDI GTCTC 1 cut(s) 223
BfaI CTAG 1 cut(s) 33
Bse1I ACTGG 2 cut(s) 118, 220
BseMII CTCAG 2 cut(s) 163, 216
BseNI ACTGG 2 cut(s) 118, 220
BslFI GGGAC 1 cut(s) 160
BsmAI GTCTC 1 cut(s) 223
BsmFI GGGAC 1 cut(s) 160
BsmI GAATGC 1 cut(s) 83
Bsp143I GATC 2 cut(s) 55, 114
BspCNI CTCAG 2 cut(s) 162, 217
BspPI GGATC 2 cut(s) 50, 109
BsrI ACTGG 2 cut(s) 118, 220
BssMI GATC 2 cut(s) 55, 114
BstDEI CTNAG 2 cut(s) 149, 225
BstKTI GATC 2 cut(s) 58, 117
BstMAI GTCTC 1 cut(s) 223
BstMBI GATC 2 cut(s) 55, 114
BstMWI GCNNNNNNNGC 1 cut(s) 38
BstX2I RGATCY 1 cut(s) 114
BstYI RGATCY 1 cut(s) 114
BtsI GCAGTG 1 cut(s) 214
BtsIMutI CAGTG 2 cut(s) 157, 214
CviAII CATG 2 cut(s) 92, 240
CviJI RGCY 3 cut(s) 25, 32, 41
CviKI_1 RGCY 3 cut(s) 25, 32, 41
DdeI CTNAG 2 cut(s) 149, 225
DpnI GATC 2 cut(s) 57, 116
DpnII GATC 2 cut(s) 55, 114
Eco57I CTGAAG 1 cut(s) 5
FaeI CATG 2 cut(s) 95, 243
FaiI YATR 4 cut(s) 70, 93, 197, 241
FaqI GGGAC 1 cut(s) 160
FatI CATG 2 cut(s) 91, 239
FspBI CTAG 1 cut(s) 33
Hin1II CATG 2 cut(s) 95, 243
HinfI GANTC 2 cut(s) 139, 254
Hpy188I TCNGA 1 cut(s) 226
Hpy188III TCNNGA 2 cut(s) 136, 266
HpyCH4V TGCA 2 cut(s) 81, 95
HpyF10VI GCNNNNNNNGC 1 cut(s) 38
HpyF3I CTNAG 2 cut(s) 149, 225
Hsp92II CATG 2 cut(s) 95, 243
Kzo9I GATC 2 cut(s) 55, 114
LmnI GCTCC 1 cut(s) 30
LpnPI CCDG 4 cut(s) 121, 125, 131, 233
MaeI CTAG 1 cut(s) 33
MalI GATC 2 cut(s) 57, 116
MboI GATC 2 cut(s) 55, 114
MboII GAAGA 1 cut(s) 11
MflI RGATCY 1 cut(s) 114
MluCI AATT 2 cut(s) 97, 103
MnlI CCTC 1 cut(s) 54
MroXI GAANNNNTTC 1 cut(s) 164
Mva1269I GAATGC 1 cut(s) 83
MwoI GCNNNNNNNGC 1 cut(s) 38
NdeII GATC 2 cut(s) 55, 114
NlaIII CATG 2 cut(s) 95, 243
PctI GAATGC 1 cut(s) 83
PdmI GAANNNNTTC 1 cut(s) 164
PfeI GAWTC 2 cut(s) 139, 254
PsuI RGATCY 1 cut(s) 114
Sau3AI GATC 2 cut(s) 55, 114
SetI ASST 2 cut(s) 27, 34
Sse9I AATT 2 cut(s) 97, 103
SspMI CTAG 1 cut(s) 33
TasI AATT 2 cut(s) 97, 103
TfiI GAWTC 2 cut(s) 139, 254
TscAI CASTG 2 cut(s) 157, 221
TspDTI ATGAA 2 cut(s) 90, 184
TspRI CASTG 2 cut(s) 157, 221
XmnI GAANNNNTTC 1 cut(s) 164
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.