Rmu_co8210604.1_g000001

2-oxoisovalerate dehydrogenase subunit alpha

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8210604.1
Physical Location & Seq
Forward (+)
435 .. 713
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8210604.1_g000001.1.cds

Sequence Viewer

Length: 279 bp
atgatggctctctgggtccggaaatcacgagactttatgatcaaccgtttcaagtccaagatgggttctttgggtttgatccatttcagctcttgcagttcatctttcactcgtaaatctccggtcctggttccttttccggcttcatttgctcaaaaccacagaatcccggagggagagtttggaaacccgccggcccatttccgtttctgctctcgtcgttttgaatccggtaaagcagaaacgctctacgacgagggtgatgccaatcaggtataa

Protein Analysis

92

Amino Acids

10.48

Weight (kDa)

9.78

Isoelectric Point (pI)

53.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 18
AciI CCGC 1 cut(s) 191
AclWI GGATC 1 cut(s) 73
AgsI TTSAA 2 cut(s) 52, 227
AjnI CCWGG 1 cut(s) 126
AluBI AGCT 1 cut(s) 90
AluI AGCT 1 cut(s) 90
Alw26I GTCTC 1 cut(s) 24
AlwI GGATC 1 cut(s) 73
Aor13HI TCCGGA 1 cut(s) 18
AoxI GGCC 1 cut(s) 195
AspS9I GGNCC 3 cut(s) 16, 124, 196
AsuC2I CCSGG 1 cut(s) 170
AsuHPI GGTGA 1 cut(s) 272
AvaII GGWCC 2 cut(s) 16, 124
BauI CACGAG 1 cut(s) 27
BccI CCATC 1 cut(s) 55
BcgI CGANNNNNNTGC 2 cut(s) 245, 279
BciT130I CCWGG 1 cut(s) 128
BclI TGATCA 1 cut(s) 39
BcnI CCSGG 1 cut(s) 170
BcoDI GTCTC 1 cut(s) 24
Bme1390I CCNGG 2 cut(s) 128, 170
Bme18I GGWCC 2 cut(s) 16, 124
BmgT120I GGNCC 3 cut(s) 16, 124, 196
BmiI GGNNCC 2 cut(s) 17, 132
BmrFI CCNGG 2 cut(s) 128, 170
BmsI GCATC 1 cut(s) 253
BpuMI CCSGG 1 cut(s) 170
BsaBI GATNNNNATC 1 cut(s) 267
BsaWI WCCGGW 3 cut(s) 18, 121, 230
BsaXI ACNNNNNCTCC 2 cut(s) 164, 194
Bse118I RCCGGY 1 cut(s) 193
Bse8I GATNNNNATC 1 cut(s) 267
BseAI TCCGGA 1 cut(s) 18
BseBI CCWGG 1 cut(s) 128
BseJI GATNNNNATC 1 cut(s) 267
BshFI GGCC 1 cut(s) 197
BsiSI CCGG 6 cut(s) 19, 122, 140, 170, 194, 231
BsmAI GTCTC 1 cut(s) 24
BsnI GGCC 1 cut(s) 197
Bsp13I TCCGGA 1 cut(s) 18
Bsp143I GATC 2 cut(s) 39, 78
BspACI CCGC 1 cut(s) 191
BspANI GGCC 1 cut(s) 197
BspEI TCCGGA 1 cut(s) 18
BspLI GGNNCC 2 cut(s) 17, 132
BspPI GGATC 1 cut(s) 73
BsrFI RCCGGY 1 cut(s) 193
BssAI RCCGGY 1 cut(s) 193
BssMI GATC 2 cut(s) 39, 78
BssSI CACGAG 1 cut(s) 27
Bst2BI CACGAG 1 cut(s) 27
Bst2UI CCWGG 1 cut(s) 128
Bst4CI ACNGT 1 cut(s) 47
BstC8I GCNNGC 1 cut(s) 195
BstKTI GATC 2 cut(s) 42, 81
BstMAI GTCTC 1 cut(s) 24
BstMBI GATC 2 cut(s) 39, 78
BstMWI GCNNNNNNNGC 1 cut(s) 149
BstNI CCWGG 1 cut(s) 128
BstSCI CCNGG 2 cut(s) 126, 168
BsuRI GGCC 1 cut(s) 197
Cac8I GCNNGC 1 cut(s) 195
Cfr10I RCCGGY 1 cut(s) 193
Cfr13I GGNCC 3 cut(s) 16, 124, 196
CviJI RGCY 4 cut(s) 8, 90, 143, 197
CviKI_1 RGCY 4 cut(s) 8, 90, 143, 197
DpnI GATC 2 cut(s) 41, 80
DpnII GATC 2 cut(s) 39, 78
Eco47I GGWCC 2 cut(s) 16, 124
EcoRII CCWGG 1 cut(s) 126
FaiI YATR 2 cut(s) 38, 277
FauI CCCGC 1 cut(s) 198
FbaI TGATCA 1 cut(s) 39
HaeIII GGCC 1 cut(s) 197
HapII CCGG 6 cut(s) 19, 122, 140, 170, 194, 231
HinfI GANTC 2 cut(s) 165, 227
HpaII CCGG 6 cut(s) 19, 122, 140, 170, 194, 231
HphI GGTGA 1 cut(s) 272
Hpy188III TCNNGA 2 cut(s) 19, 27
Hpy99I CGWCG 2 cut(s) 222, 257
HpyCH4III ACNGT 1 cut(s) 47
HpyCH4V TGCA 1 cut(s) 96
HpyF10VI GCNNNNNNNGC 1 cut(s) 149
Kpn2I TCCGGA 1 cut(s) 18
KroI GCCGGC 1 cut(s) 193
KroNI GCCGGC 1 cut(s) 195
Ksp22I TGATCA 1 cut(s) 39
Kzo9I GATC 2 cut(s) 39, 78
LpnPI CCDG 9 cut(s) 32, 113, 135, 140, 153, 183, 207, 244, 257
LweI GCATC 1 cut(s) 253
MalI GATC 2 cut(s) 41, 80
MboI GATC 2 cut(s) 39, 78
MnlI CCTC 2 cut(s) 166, 250
MroI TCCGGA 1 cut(s) 18
MroNI GCCGGC 1 cut(s) 193
MspI CCGG 6 cut(s) 19, 122, 140, 170, 194, 231
MspR9I CCNGG 2 cut(s) 128, 170
MvaI CCWGG 1 cut(s) 128
MwoI GCNNNNNNNGC 1 cut(s) 149
NaeI GCCGGC 1 cut(s) 195
NciI CCSGG 1 cut(s) 170
NdeII GATC 2 cut(s) 39, 78
NgoMIV GCCGGC 1 cut(s) 193
NlaIV GGNNCC 2 cut(s) 17, 132
PdiI GCCGGC 1 cut(s) 195
PfeI GAWTC 2 cut(s) 165, 227
PfoI TCCNGGA 1 cut(s) 168
Psp6I CCWGG 1 cut(s) 126
PspGI CCWGG 1 cut(s) 126
PspN4I GGNNCC 2 cut(s) 17, 132
PspPI GGNCC 3 cut(s) 16, 124, 196
Sau3AI GATC 2 cut(s) 39, 78
Sau96I GGNCC 3 cut(s) 16, 124, 196
ScrFI CCNGG 2 cut(s) 128, 170
SetI ASST 2 cut(s) 92, 276
SfaNI GCATC 1 cut(s) 253
SinI GGWCC 2 cut(s) 16, 124
SsiI CCGC 1 cut(s) 191
StyD4I CCNGG 2 cut(s) 126, 168
TaaI ACNGT 1 cut(s) 47
TfiI GAWTC 2 cut(s) 165, 227
TspDTI ATGAA 2 cut(s) 90, 135
TspGWI ACGGA 1 cut(s) 194
VpaK11BI GGWCC 2 cut(s) 16, 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.