Rmu_co8283749.1_g000001

acyl-activating enzyme

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8283749.1
OG0001590
Physical Location & Seq
Forward (+)
1 .. 287
287 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8283749.1_g000001.1.cds

Sequence Viewer

Length: 226 bp
ctccggaagcatggttctgattcaggttaatttggatgccaccgaaggtgcaagtccaatgaatttcaatgttgaggaatttgcaaggttggaactcccaggagatgtattctcttcccctgtaatgattggtggcagaattttcgttggttgtagggatgattatgtgcactgcattgctgttaagccccaggtctctacaggaacaatgagttgttctgtatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AMP-binding AMP-binding_C PP-binding PQQ PQQ_2 PQQ_3

Protein Analysis

74

Amino Acids

7.88

Weight (kDa)

4.5

Isoelectric Point (pI)

40.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 3
AcsI RAATTY 3 cut(s) 62, 78, 139
AgsI TTSAA 1 cut(s) 68
AjnI CCWGG 2 cut(s) 98, 190
AloI GAACNNNNNNTCC 1 cut(s) 30
Alw21I GWGCWC 1 cut(s) 172
Alw26I GTCTC 1 cut(s) 200
Alw44I GTGCAC 1 cut(s) 168
Aor13HI TCCGGA 1 cut(s) 3
ApaLI GTGCAC 1 cut(s) 168
ApoI RAATTY 3 cut(s) 62, 78, 139
BaeGI GKGCMC 1 cut(s) 172
Bbv12I GWGCWC 1 cut(s) 172
BcgI CGANNNNNNTGC 2 cut(s) 125, 159
BciT130I CCWGG 2 cut(s) 100, 192
BcoDI GTCTC 1 cut(s) 200
BfmI CTRYAG 1 cut(s) 199
Bme1390I CCNGG 2 cut(s) 100, 192
BmrFI CCNGG 2 cut(s) 100, 192
BmsI GCATC 1 cut(s) 26
BsaI GGTCTC 1 cut(s) 200
BsaJI CCNNGG 2 cut(s) 98, 190
BsaWI WCCGGW 1 cut(s) 3
Bse3DI GCAATG 1 cut(s) 175
BseAI TCCGGA 1 cut(s) 3
BseBI CCWGG 2 cut(s) 100, 192
BseDI CCNNGG 2 cut(s) 98, 190
BseGI GGATG 2 cut(s) 41, 164
BseMI GCAATG 1 cut(s) 175
BseSI GKGCMC 1 cut(s) 172
BsiHKAI GWGCWC 1 cut(s) 172
BsiSI CCGG 1 cut(s) 4
BsmAI GTCTC 1 cut(s) 200
Bso31I GGTCTC 1 cut(s) 200
Bsp1286I GDGCHC 1 cut(s) 172
Bsp13I TCCGGA 1 cut(s) 3
BspEI TCCGGA 1 cut(s) 3
BspTNI GGTCTC 1 cut(s) 200
BsrDI GCAATG 1 cut(s) 175
BssECI CCNNGG 2 cut(s) 98, 190
Bst2UI CCWGG 2 cut(s) 100, 192
Bst6I CTCTTC 1 cut(s) 119
BstF5I GGATG 2 cut(s) 41, 164
BstMAI GTCTC 1 cut(s) 200
BstNI CCWGG 2 cut(s) 100, 192
BstSCI CCNGG 2 cut(s) 98, 190
BstSFI CTRYAG 1 cut(s) 199
BstSLI GKGCMC 1 cut(s) 172
BtsCI GGATG 2 cut(s) 41, 164
BtsI GCAGTG 1 cut(s) 170
BtsIMutI CAGTG 1 cut(s) 170
CviAII CATG 1 cut(s) 11
CviJI RGCY 1 cut(s) 188
CviKI_1 RGCY 1 cut(s) 188
Eam1104I CTCTTC 1 cut(s) 119
EarI CTCTTC 1 cut(s) 119
Eco31I GGTCTC 1 cut(s) 200
EcoRII CCWGG 2 cut(s) 98, 190
FaeI CATG 1 cut(s) 14
FaiI YATR 3 cut(s) 12, 166, 224
FatI CATG 1 cut(s) 10
FokI GGATG 2 cut(s) 48, 171
HapII CCGG 1 cut(s) 4
Hin1II CATG 1 cut(s) 14
HinfI GANTC 1 cut(s) 20
HpaII CCGG 1 cut(s) 4
Hpy166II GTNNAC 1 cut(s) 170
Hpy188I TCNGA 1 cut(s) 19
Hpy188III TCNNGA 1 cut(s) 4
Hpy8I GTNNAC 1 cut(s) 170
HpyAV CCTTC 1 cut(s) 39
HpyCH4V TGCA 4 cut(s) 51, 84, 170, 175
Hsp92II CATG 1 cut(s) 14
Kpn2I TCCGGA 1 cut(s) 3
LpnPI CCDG 8 cut(s) 9, 17, 85, 112, 133, 177, 187, 204
LweI GCATC 1 cut(s) 26
MboII GAAGA 1 cut(s) 106
MhlI GDGCHC 1 cut(s) 172
MluCI AATT 4 cut(s) 29, 62, 78, 139
MmeI TCCRAC 1 cut(s) 70
MnlI CCTC 1 cut(s) 68
MroI TCCGGA 1 cut(s) 3
MseI TTAA 2 cut(s) 28, 184
MspI CCGG 1 cut(s) 4
MspR9I CCNGG 2 cut(s) 100, 192
MvaI CCWGG 2 cut(s) 100, 192
NlaIII CATG 1 cut(s) 14
PfeI GAWTC 1 cut(s) 20
Psp6I CCWGG 2 cut(s) 98, 190
PspGI CCWGG 2 cut(s) 98, 190
SaqAI TTAA 2 cut(s) 28, 184
ScrFI CCNGG 2 cut(s) 100, 192
SduI GDGCHC 1 cut(s) 172
SetI ASST 4 cut(s) 28, 50, 90, 196
SfaNI GCATC 1 cut(s) 26
SfcI CTRYAG 1 cut(s) 199
Sse9I AATT 4 cut(s) 29, 62, 78, 139
StyD4I CCNGG 2 cut(s) 98, 190
TasI AATT 4 cut(s) 29, 62, 78, 139
TfiI GAWTC 1 cut(s) 20
Tru1I TTAA 2 cut(s) 28, 184
Tru9I TTAA 2 cut(s) 28, 184
TscAI CASTG 1 cut(s) 177
TspDTI ATGAA 1 cut(s) 75
TspRI CASTG 1 cut(s) 177
VneI GTGCAC 1 cut(s) 168
XapI RAATTY 3 cut(s) 62, 78, 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.