Rmu_co8347725.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8347725.1
Physical Location & Seq
Forward (+)
22 .. 585
564 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8347725.1_g000001.1.cds

Sequence Viewer

Length: 564 bp
atgaagacagtgaagccagacagcaaaagtcgtgttcagcttcattctctggtccaactatatagtaatgcttataaggttattaagaacataaaagttgaacctgatgttgaggcctggagttcttttctgtctgcttgtaaagagcacaaacagtttgggatgtcggaaagagtagctagggaggtcatgaaaacagtgaagccagacagcaaacatggtgctcggcttcatcctctgatccaactatatagtaatgcaggcctgctagaggaagcttataaggttatcaaggacatgaaactcaaaccttatgttgcgtcctggatttcttttctttctgcttgtaaggagcataaacagtttgggatggttgaaagagtagctgagacggtcatgatgacagtgaagctgcacagcaaacatggtgctccgcttcattctcatatctcagatatgagggatttgagaaagtcaatggccaatccaaatttagggaagatacatgatttgctgcaaaaatttgacgaaggccagggagctatatgttttgatgcacggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

187

Amino Acids

21.28

Weight (kDa)

9.52

Isoelectric Point (pI)

28.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 75, 282
AciI CCGC 1 cut(s) 434
AclWI GGATC 1 cut(s) 235
AcoI YGGCCR 1 cut(s) 480
AcsI RAATTY 2 cut(s) 490, 521
AfiI CCNNNNNNNGG 2 cut(s) 271, 494
AgsI TTSAA 2 cut(s) 101, 377
AjnI CCWGG 3 cut(s) 116, 323, 534
AluBI AGCT 6 cut(s) 40, 179, 278, 386, 412, 542
AluI AGCT 6 cut(s) 40, 179, 278, 386, 412, 542
Alw21I GWGCWC 3 cut(s) 150, 226, 433
Alw26I GTCTC 1 cut(s) 383
AlwI GGATC 1 cut(s) 235
AoxI GGCC 4 cut(s) 114, 262, 480, 532
ApeKI GCWGC 2 cut(s) 412, 514
ApoI RAATTY 2 cut(s) 490, 521
AspS9I GGNCC 1 cut(s) 52
AvaII GGWCC 1 cut(s) 52
BalI TGGCCA 1 cut(s) 482
BbsI GAAGAC 1 cut(s) 11
Bbv12I GWGCWC 3 cut(s) 150, 226, 433
BbvI GCAGC 2 cut(s) 399, 501
BccI CCATC 1 cut(s) 364
BciT130I CCWGG 3 cut(s) 118, 325, 536
BcoDI GTCTC 1 cut(s) 383
BfaI CTAG 2 cut(s) 180, 269
BisI GCNGC 2 cut(s) 413, 515
BlsI GCNGC 2 cut(s) 414, 516
Bme1390I CCNGG 3 cut(s) 118, 325, 536
Bme18I GGWCC 1 cut(s) 52
BmgT120I GGNCC 1 cut(s) 52
BmrFI CCNGG 3 cut(s) 118, 325, 536
BmsI GCATC 1 cut(s) 544
BpiI GAAGAC 1 cut(s) 11
BpmI CTGGAG 1 cut(s) 139
BsaJI CCNNGG 1 cut(s) 535
Bsc4I CCNNNNNNNGG 2 cut(s) 271, 494
BseBI CCWGG 3 cut(s) 118, 325, 536
BseDI CCNNGG 1 cut(s) 535
BseGI GGATG 3 cut(s) 168, 232, 375
BseLI CCNNNNNNNGG 2 cut(s) 271, 494
BseMII CTCAG 2 cut(s) 378, 465
BseXI GCAGC 2 cut(s) 399, 501
BsgI GTGCAG 1 cut(s) 398
BshFI GGCC 4 cut(s) 116, 264, 482, 534
BsiHKAI GWGCWC 3 cut(s) 150, 226, 433
BslI CCNNNNNNNGG 2 cut(s) 271, 494
BsmAI GTCTC 1 cut(s) 383
BsmBI CGTCTC 1 cut(s) 383
BsnI GGCC 4 cut(s) 116, 264, 482, 534
Bsp1286I GDGCHC 3 cut(s) 150, 226, 433
Bsp143I GATC 1 cut(s) 240
BspACI CCGC 1 cut(s) 434
BspANI GGCC 4 cut(s) 116, 264, 482, 534
BspCNI CTCAG 2 cut(s) 379, 464
BspHI TCATGA 2 cut(s) 189, 396
BspPI GGATC 1 cut(s) 235
BssECI CCNNGG 1 cut(s) 535
BssMI GATC 1 cut(s) 240
Bst2UI CCWGG 3 cut(s) 118, 325, 536
Bst4CI ACNGT 7 cut(s) 10, 156, 199, 363, 394, 406, 561
BstC8I GCNNGC 2 cut(s) 262, 266
BstDEI CTNAG 2 cut(s) 387, 451
BstENI CCTNNNNNAGG 1 cut(s) 269
BstF5I GGATG 3 cut(s) 168, 232, 375
BstKTI GATC 1 cut(s) 243
BstMAI GTCTC 1 cut(s) 383
BstMBI GATC 1 cut(s) 240
BstNI CCWGG 3 cut(s) 118, 325, 536
BstSCI CCNGG 3 cut(s) 116, 323, 534
BstV1I GCAGC 2 cut(s) 399, 501
BstV2I GAAGAC 1 cut(s) 11
BsuRI GGCC 4 cut(s) 116, 264, 482, 534
BtsCI GGATG 3 cut(s) 168, 232, 375
BtsIMutI CAGTG 3 cut(s) 15, 204, 411
Cac8I GCNNGC 2 cut(s) 262, 266
CciI TCATGA 2 cut(s) 189, 396
Cfr13I GGNCC 1 cut(s) 52
CseI GACGC 1 cut(s) 309
CviAII CATG 6 cut(s) 190, 218, 298, 397, 425, 506
DdeI CTNAG 2 cut(s) 387, 451
DpnI GATC 1 cut(s) 242
DpnII GATC 1 cut(s) 240
EaeI YGGCCR 1 cut(s) 480
Eco147I AGGCCT 2 cut(s) 116, 264
Eco47I GGWCC 1 cut(s) 52
EcoNI CCTNNNNNAGG 1 cut(s) 269
EcoRII CCWGG 3 cut(s) 116, 323, 534
Esp3I CGTCTC 1 cut(s) 383
FaeI CATG 6 cut(s) 193, 221, 301, 400, 428, 509
FatI CATG 6 cut(s) 189, 217, 297, 396, 424, 505
Fnu4HI GCNGC 2 cut(s) 413, 515
FokI GGATG 3 cut(s) 175, 219, 382
Fsp4HI GCNGC 2 cut(s) 413, 515
FspBI CTAG 2 cut(s) 180, 269
GluI GCNGC 2 cut(s) 413, 515
GsuI CTGGAG 1 cut(s) 139
HaeIII GGCC 4 cut(s) 116, 264, 482, 534
HgaI GACGC 1 cut(s) 309
Hin1II CATG 6 cut(s) 193, 221, 301, 400, 428, 509
HindIII AAGCTT 1 cut(s) 276
Hpy188I TCNGA 3 cut(s) 169, 240, 454
Hpy188III TCNNGA 2 cut(s) 190, 397
HpyAV CCTTC 1 cut(s) 524
HpyCH4III ACNGT 7 cut(s) 10, 156, 199, 363, 394, 406, 561
HpyCH4V TGCA 4 cut(s) 260, 415, 517, 557
HpyF3I CTNAG 2 cut(s) 387, 451
Hsp92II CATG 6 cut(s) 193, 221, 301, 400, 428, 509
Kzo9I GATC 1 cut(s) 240
LmnI GCTCC 3 cut(s) 352, 436, 539
Lsp1109I GCAGC 2 cut(s) 399, 501
LweI GCATC 1 cut(s) 544
MaeI CTAG 2 cut(s) 180, 269
MalI GATC 1 cut(s) 242
MboI GATC 1 cut(s) 240
MboII GAAGA 2 cut(s) 16, 511
MhlI GDGCHC 3 cut(s) 150, 226, 433
MlsI TGGCCA 1 cut(s) 482
MluCI AATT 2 cut(s) 490, 521
MluNI TGGCCA 1 cut(s) 482
MmeI TCCRAC 3 cut(s) 79, 147, 268
MnlI CCTC 5 cut(s) 106, 178, 246, 265, 453
Mox20I TGGCCA 1 cut(s) 482
MscI TGGCCA 1 cut(s) 482
MseI TTAA 1 cut(s) 84
Msp20I TGGCCA 1 cut(s) 482
MspR9I CCNGG 3 cut(s) 118, 325, 536
MvaI CCWGG 3 cut(s) 118, 325, 536
NdeII GATC 1 cut(s) 240
NlaIII CATG 6 cut(s) 193, 221, 301, 400, 428, 509
NmeAIII GCCGAG 1 cut(s) 205
PagI TCATGA 2 cut(s) 189, 396
PceI AGGCCT 2 cut(s) 116, 264
PfoI TCCNGGA 1 cut(s) 323
PkrI GCNGC 2 cut(s) 414, 516
PsiI TTATAA 2 cut(s) 75, 282
Psp6I CCWGG 3 cut(s) 116, 323, 534
PspGI CCWGG 3 cut(s) 116, 323, 534
PspPI GGNCC 1 cut(s) 52
SaqAI TTAA 1 cut(s) 84
SatI GCNGC 2 cut(s) 413, 515
Sau3AI GATC 1 cut(s) 240
Sau96I GGNCC 1 cut(s) 52
ScrFI CCNGG 3 cut(s) 118, 325, 536
SduI GDGCHC 3 cut(s) 150, 226, 433
SfaNI GCATC 1 cut(s) 544
SinI GGWCC 1 cut(s) 52
Sse9I AATT 2 cut(s) 490, 521
SseBI AGGCCT 2 cut(s) 116, 264
SsiI CCGC 1 cut(s) 434
SspMI CTAG 2 cut(s) 180, 269
StuI AGGCCT 2 cut(s) 116, 264
StyD4I CCNGG 3 cut(s) 116, 323, 534
TaaI ACNGT 7 cut(s) 10, 156, 199, 363, 394, 406, 561
TasI AATT 2 cut(s) 490, 521
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TscAI CASTG 3 cut(s) 15, 204, 411
TseI GCWGC 2 cut(s) 412, 514
TspDTI ATGAA 6 cut(s) 17, 32, 206, 221, 314, 428
TspRI CASTG 3 cut(s) 15, 204, 411
VpaK11BI GGWCC 1 cut(s) 52
XagI CCTNNNNNAGG 1 cut(s) 269
XapI RAATTY 2 cut(s) 490, 521
XspI CTAG 2 cut(s) 180, 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.