Rmu_sc0023070.1_g000006

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0023070.1
Physical Location & Seq
Reverse (-)
18733 .. 19056
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0023070.1_g000006.1.cds

Sequence Viewer

Length: 324 bp
atggtcgatttgtatggcaaggtggggctgttagcggaagcctatgattttattaagaacatgagacttgaacccaatattgctgtctggggagcttttttgtcggcttgcaaggagcataaacagtttgagatggccgaaagagttgttgaggaggttatgaagatggtgaaaccagagaatgatagtggggtttactttcttatcgccggtttgtatgttttgggtggaaagtgggatgatgctgaaagagtgaggaaattaatggtgaaccacaaggtgaggaaggttaggggctctagttttgttcaagtggatagttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

12.23

Weight (kDa)

7.84

Isoelectric Point (pI)

26.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 35
AcoI YGGCCR 1 cut(s) 135
AdeI CACNNNGTG 1 cut(s) 280
AgsI TTSAA 2 cut(s) 71, 311
AluBI AGCT 1 cut(s) 95
AluI AGCT 1 cut(s) 95
Alw26I GTCTC 1 cut(s) 58
AoxI GGCC 1 cut(s) 135
AseI ATTAAT 1 cut(s) 263
AsuHPI GGTGA 3 cut(s) 181, 280, 292
BanII GRGCYC 1 cut(s) 299
BccI CCATC 2 cut(s) 127, 160
BcoDI GTCTC 1 cut(s) 58
BfaI CTAG 1 cut(s) 300
BmsI GCATC 1 cut(s) 232
Bse118I RCCGGY 1 cut(s) 209
BseGI GGATG 1 cut(s) 244
BseRI GAGGAG 1 cut(s) 167
BshFI GGCC 1 cut(s) 137
BsiSI CCGG 1 cut(s) 210
BsmAI GTCTC 1 cut(s) 58
BsnI GGCC 1 cut(s) 137
Bsp1286I GDGCHC 1 cut(s) 299
BspACI CCGC 1 cut(s) 35
BspANI GGCC 1 cut(s) 137
BsrFI RCCGGY 1 cut(s) 209
BssAI RCCGGY 1 cut(s) 209
Bst4CI ACNGT 1 cut(s) 126
BstC8I GCNNGC 1 cut(s) 109
BstF5I GGATG 1 cut(s) 244
BstMAI GTCTC 1 cut(s) 58
BsuRI GGCC 1 cut(s) 137
BtsCI GGATG 1 cut(s) 244
Cac8I GCNNGC 1 cut(s) 109
Cfr10I RCCGGY 1 cut(s) 209
CviAII CATG 1 cut(s) 61
CviJI RGCY 6 cut(s) 28, 41, 95, 107, 137, 297
CviKI_1 RGCY 6 cut(s) 28, 41, 95, 107, 137, 297
DraIII CACNNNGTG 1 cut(s) 280
EaeI YGGCCR 1 cut(s) 135
Eco24I GRGCYC 1 cut(s) 299
EcoT38I GRGCYC 1 cut(s) 299
FaeI CATG 1 cut(s) 64
FaiI YATR 6 cut(s) 15, 45, 62, 120, 161, 219
FatI CATG 1 cut(s) 60
FokI GGATG 1 cut(s) 251
FriOI GRGCYC 1 cut(s) 299
FspBI CTAG 1 cut(s) 300
HaeIII GGCC 1 cut(s) 137
HapII CCGG 1 cut(s) 210
Hin1II CATG 1 cut(s) 64
HpaII CCGG 1 cut(s) 210
HphI GGTGA 3 cut(s) 181, 280, 292
Hpy166II GTNNAC 2 cut(s) 196, 271
Hpy8I GTNNAC 2 cut(s) 196, 271
HpyAV CCTTC 1 cut(s) 280
HpyCH4III ACNGT 1 cut(s) 126
HpyCH4V TGCA 1 cut(s) 111
Hsp92II CATG 1 cut(s) 64
LmnI GCTCC 2 cut(s) 92, 115
LpnPI CCDG 3 cut(s) 73, 189, 223
LweI GCATC 1 cut(s) 232
MaeI CTAG 1 cut(s) 300
MboII GAAGA 1 cut(s) 175
MhlI GDGCHC 1 cut(s) 299
MluCI AATT 1 cut(s) 260
MnlI CCTC 4 cut(s) 145, 148, 249, 276
MseI TTAA 2 cut(s) 54, 263
MspI CCGG 1 cut(s) 210
NlaIII CATG 1 cut(s) 64
PshBI ATTAAT 1 cut(s) 263
SaqAI TTAA 2 cut(s) 54, 263
SduI GDGCHC 1 cut(s) 299
SetI ASST 5 cut(s) 24, 97, 159, 282, 291
SfaNI GCATC 1 cut(s) 232
Sse9I AATT 1 cut(s) 260
SsiI CCGC 1 cut(s) 35
SspI AATATT 1 cut(s) 79
SspMI CTAG 1 cut(s) 300
TaaI ACNGT 1 cut(s) 126
TaqI TCGA 1 cut(s) 6
TasI AATT 1 cut(s) 260
Tru1I TTAA 2 cut(s) 54, 263
Tru9I TTAA 2 cut(s) 54, 263
TspDTI ATGAA 1 cut(s) 176
VspI ATTAAT 1 cut(s) 263
XspI CTAG 1 cut(s) 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.