Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8413375.1

Orthogroup ID

OG0001577

Physical Location & Seq

Genomic Coordinates Reverse (-)

401 .. 1265

Gene Structure 865 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8413375.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 567 bp

atggggaaaagctcagatgtggtgattgaaaatgagaatgccagcaatagtaaagacattaaaaggcaggattccttttcgtcgaaatcatcctatcaggatatccccttgcttatacctcaagaggctgatgggttgaatgaaaacccaagaccatatggggtggactctgctcatttcctcgatcagccaagcagagttggtaacaatcttgctttcccttttcggaagacaaaaattgaaccagtaggtccagatacgccaatgaggggatttgtagatgactttgaatctatggatcgacatgggaaattggcttcagacgtggtggcacgtcctgcaatcacaaattcagatccagagtggtgggaaatacaagaacggggaaatgagggtggtttcacagatgaatcaggacaagttggtccttctagttcatgccgttgtcaggttatcagaagtgtcagtcagtggtcagcaggaacaagccaagttgaagatagcattcacagtgcttattgttctcttatcgataaagctgagcactttatttacattgaggtatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004620 GO:0004630 GO:0006629 GO:0007275 GO:0008081 GO:0008150 GO:0008152 GO:0008610 GO:0009058 GO:0016298 GO:0016787 GO:0016788 GO:0022622 GO:0032501 GO:0032502 GO:0042578 GO:0044238 GO:0048364 GO:0048731 GO:0048856 GO:0071704 GO:0099402 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00564 ko00565 ko01100 ko01110 ko04014 ko04024 ko04071 ko04072 ko04144 ko04666 ko04724 ko04912 ko05231 map00564 map00565 map01100 map01110 map04014 map04024 map04071 map04072 map04144 map04666 map04724 map04912 map05231

Pfam Domains

Protein Families

PLDc PLDc_2

Protein Analysis

188

Amino Acids

20.81

Weight (kDa)

4.69

Isoelectric Point (pI)

39.58

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001577)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G16785 AT3G16785 AT3G16785 AT3G16785 AT3G16785 AT3G16785
fragaria_vesca	FvH4_4g18810 FvH4_6g06940 FvH4_6g06940 FvH4_6g06940
malus_domestica	MD04G1197500.v1.1 MD12G1210300.v1.1 MD13G1162600.v1.1 MD16G1162400.v1.1
prunus_persica	Prupe.1G130000_v2.0.a1 Prupe.1G130000_v2.0.a1 Prupe.1G130000_v2.0.a1 Prupe.1G130000_v2.0.a1 Prupe.1G130000_v2.0.a1 Prupe.1G130000_v2.0.a1 Prupe.1G130000_v2.0.a1 Prupe.6G317900_v2.0.a1 Prupe.6G317900_v2.0.a1 Prupe.6G317900_v2.0.a1
pyrus_communis	pycom04g17480 pycom13g13890 pycom16g13770
rosa_chinensis	RchiOBHm_Chr3g0456481 RchiOBHm_Chr4g0423621
rosa_laevigata	RLG00000007541 RLG00000025302
rosa_multiflora	Rmu_co8413375.1_g000001 Rmu_sc0000464.1_g000017 Rmu_sc0002607.1_g000011 Rmu_sc0008373.1_g000012 Rmu_sc0016309.1_g000001
rosa_roxburghii	Rroxscaffold_5G00365830 Rroxscaffold_6G00422720
rosa_rugosa	Rorug03G0013400 Rorug03G0013400 Rorug03G0013400 Rorug04G0189100
rosa_samantha	Rh3AG073700 Rh3BG075600 Rh3DG076900 Rh4AG248700 Rh4BG254000 Rh4DG249000
rosa_wichuraiana	Rw3G006320 Rw4G021300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	423
AclWI	GGATC	2 cut(s)	306, 350
AcsI	RAATTY	1 cut(s)	349
AcuI	CTGAAG	1 cut(s)	303
AfiI	CCNNNNNNNGG	2 cut(s)	269, 448
AgsI	TTSAA	5 cut(s)	29, 139, 242, 290, 497
AjiI	CACGTC	2 cut(s)	325, 335
AluBI	AGCT	2 cut(s)	12, 539
AluI	AGCT	2 cut(s)	12, 539
Alw21I	GWGCWC	1 cut(s)	546
AlwI	GGATC	2 cut(s)	306, 350
ApoI	RAATTY	1 cut(s)	349
AspS9I	GGNCC	2 cut(s)	251, 425
AsuHPI	GGTGA	1 cut(s)	34
AvaII	GGWCC	2 cut(s)	251, 425
BbsI	GAAGAC	1 cut(s)	236
Bbv12I	GWGCWC	1 cut(s)	546
BccI	CCATC	1 cut(s)	125
BceAI	ACGGC	1 cut(s)	426
BfaI	CTAG	1 cut(s)	432
BlpI	GCTNAGC	1 cut(s)	540
Bme18I	GGWCC	2 cut(s)	251, 425
BmgBI	CACGTC	2 cut(s)	325, 335
BmgT120I	GGNCC	2 cut(s)	251, 425
BpiI	GAAGAC	1 cut(s)	236
Bpu1102I	GCTNAGC	1 cut(s)	540
BpuEI	CTTGAG	1 cut(s)	105
Bsa29I	ATCGAT	1 cut(s)	531
Bsc4I	CCNNNNNNNGG	2 cut(s)	269, 448
Bse1I	ACTGG	1 cut(s)	245
BseCI	ATCGAT	1 cut(s)	531
BseGI	GGATG	1 cut(s)	89
BseLI	CCNNNNNNNGG	2 cut(s)	269, 448
BseMII	CTCAG	2 cut(s)	27, 531
BseNI	ACTGG	1 cut(s)	245
BshVI	ATCGAT	1 cut(s)	531
BsiHKAI	GWGCWC	1 cut(s)	546
BslI	CCNNNNNNNGG	2 cut(s)	269, 448
BsmI	GAATGC	2 cut(s)	43, 504
Bsp1286I	GDGCHC	1 cut(s)	546
Bsp143I	GATC	3 cut(s)	184, 298, 355
Bsp1720I	GCTNAGC	1 cut(s)	540
BspCNI	CTCAG	2 cut(s)	26, 532
BspDI	ATCGAT	1 cut(s)	531
BspPI	GGATC	2 cut(s)	306, 350
BsrI	ACTGG	1 cut(s)	245
BssMI	GATC	3 cut(s)	184, 298, 355
Bst4CI	ACNGT	1 cut(s)	512
BstAPI	GCANNNNNTGC	1 cut(s)	338
BstC8I	GCNNGC	1 cut(s)	43
BstDEI	CTNAG	2 cut(s)	13, 540
BstF5I	GGATG	1 cut(s)	89
BstKTI	GATC	3 cut(s)	187, 301, 358
BstMBI	GATC	3 cut(s)	184, 298, 355
BstMWI	GCNNNNNNNGC	1 cut(s)	338
BstV2I	GAAGAC	1 cut(s)	236
BstX2I	RGATCY	1 cut(s)	355
BstXI	CCANNNNNNTGG	1 cut(s)	366
BstYI	RGATCY	1 cut(s)	355
Bsu15I	ATCGAT	1 cut(s)	531
BsuTUI	ATCGAT	1 cut(s)	531
BtrI	CACGTC	2 cut(s)	325, 335
BtsCI	GGATG	1 cut(s)	89
BtsIMutI	CAGTG	2 cut(s)	476, 517
Cac8I	GCNNGC	1 cut(s)	43
Cfr13I	GGNCC	2 cut(s)	251, 425
ClaI	ATCGAT	1 cut(s)	531
CviAII	CATG	2 cut(s)	305, 438
CviJI	RGCY	6 cut(s)	12, 128, 190, 317, 489, 539
CviKI_1	RGCY	6 cut(s)	12, 128, 190, 317, 489, 539
DdeI	CTNAG	2 cut(s)	13, 540
DpnI	GATC	3 cut(s)	186, 300, 357
DpnII	GATC	3 cut(s)	184, 298, 355
DrdI	GACNNNNNNGTC	1 cut(s)	423
DseDI	GACNNNNNNGTC	1 cut(s)	423
Eco32I	GATATC	1 cut(s)	103
Eco47I	GGWCC	2 cut(s)	251, 425
Eco57I	CTGAAG	1 cut(s)	303
EcoRV	GATATC	1 cut(s)	103
FaeI	CATG	2 cut(s)	308, 441
FaiI	YATR	7 cut(s)	116, 157, 159, 296, 306, 439, 565
FatI	CATG	2 cut(s)	304, 437
FauNDI	CATATG	1 cut(s)	157
FokI	GGATG	1 cut(s)	76
FspBI	CTAG	1 cut(s)	432
Hin1II	CATG	2 cut(s)	308, 441
HinfI	GANTC	4 cut(s)	71, 167, 290, 410
HphI	GGTGA	1 cut(s)	34
Hpy166II	GTNNAC	1 cut(s)	166
Hpy188I	TCNGA	5 cut(s)	16, 228, 322, 355, 458
Hpy188III	TCNNGA	5 cut(s)	98, 122, 254, 359, 414
Hpy8I	GTNNAC	1 cut(s)	166
Hpy99I	CGWCG	1 cut(s)	85
HpyAV	CCTTC	1 cut(s)	438
HpyCH4III	ACNGT	1 cut(s)	512
HpyCH4IV	ACGT	2 cut(s)	324, 334
HpyCH4V	TGCA	1 cut(s)	341
HpyF10VI	GCNNNNNNNGC	1 cut(s)	338
HpyF3I	CTNAG	2 cut(s)	13, 540
HpySE526I	ACGT	2 cut(s)	324, 334
Hsp92II	CATG	2 cut(s)	308, 441
Kzo9I	GATC	3 cut(s)	184, 298, 355
MaeI	CTAG	1 cut(s)	432
MaeII	ACGT	2 cut(s)	324, 334
MaeIII	GTNAC	1 cut(s)	203
MalI	GATC	3 cut(s)	186, 300, 357
MboI	GATC	3 cut(s)	184, 298, 355
MboII	GAAGA	2 cut(s)	241, 509
MflI	RGATCY	1 cut(s)	355
MhlI	GDGCHC	1 cut(s)	546
MluCI	AATT	3 cut(s)	237, 311, 349
MlyI	GAGTC	1 cut(s)	161
MnlI	CCTC	6 cut(s)	118, 129, 191, 261, 385, 553
MseI	TTAA	1 cut(s)	60
Mva1269I	GAATGC	2 cut(s)	43, 504
MwoI	GCNNNNNNNGC	1 cut(s)	338
NdeI	CATATG	1 cut(s)	157
NdeII	GATC	3 cut(s)	184, 298, 355
NlaIII	CATG	2 cut(s)	308, 441
PctI	GAATGC	2 cut(s)	43, 504
PfeI	GAWTC	3 cut(s)	71, 290, 410
PleI	GAGTC	1 cut(s)	161
PpsI	GAGTC	1 cut(s)	161
PspPI	GGNCC	2 cut(s)	251, 425
PsuI	RGATCY	1 cut(s)	355
SaqAI	TTAA	1 cut(s)	60
Sau3AI	GATC	3 cut(s)	184, 298, 355
Sau96I	GGNCC	2 cut(s)	251, 425
SchI	GAGTC	1 cut(s)	161
SduI	GDGCHC	1 cut(s)	546
SetI	ASST	8 cut(s)	14, 121, 253, 327, 337, 453, 541, 564
SinI	GGWCC	2 cut(s)	251, 425
SmlI	CTYRAG	1 cut(s)	120
SmoI	CTYRAG	1 cut(s)	120
Sse9I	AATT	3 cut(s)	237, 311, 349
SspMI	CTAG	1 cut(s)	432
TaaI	ACNGT	1 cut(s)	512
TaiI	ACGT	2 cut(s)	327, 337
TaqI	TCGA	4 cut(s)	83, 183, 301, 531
TasI	AATT	3 cut(s)	237, 311, 349
TfiI	GAWTC	3 cut(s)	71, 290, 410
Tru1I	TTAA	1 cut(s)	60
Tru9I	TTAA	1 cut(s)	60
TscAI	CASTG	2 cut(s)	476, 517
TspDTI	ATGAA	3 cut(s)	156, 423, 426
TspRI	CASTG	2 cut(s)	476, 517
VpaK11BI	GGWCC	2 cut(s)	251, 425
XapI	RAATTY	1 cut(s)	349
XspI	CTAG	1 cut(s)	432

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.