Rmu_sc0016309.1_g000001

phospholipase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016309.1
Physical Location & Seq
Reverse (-)
1 .. 1581
1581 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016309.1_g000001.1.cds

Sequence Viewer

Length: 454 bp
gcattggcaatatcgaaccatttgcagagggcataattcaattctacacaatttatatgaacttcttggtccaaagacacacgactacatttctttctatggccttagagcctatggtaaactctttgatggcggtcctgtggcctccagtcaggtgtatgtgcatagtaaaatcatgattgtcgatgattgtacaactataattggatcagctaacatcaatgataggagtttgcttggttcaagagattctgagattggtcttcttattgaagacaaagagttggttaattcatatatgggaggaaaaccatggaaggctggaaaattttcattgagtcttcgcatgtcgctatggtctgaacatcttggtattcgctctggagagatggaccaaataatcgatccaactgttgattcaacttacaaggatatatggatggagacagctaag

Protein Analysis

151

Amino Acids

17.09

Weight (kDa)

6.31

Isoelectric Point (pI)

43.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 133
AclWI GGATC 2 cut(s) 215, 399
AcsI RAATTY 1 cut(s) 327
AfaI GTAC 1 cut(s) 194
AgsI TTSAA 4 cut(s) 40, 244, 273, 421
AjuI GAANNNNNNNTTGG 2 cut(s) 401, 433
AluBI AGCT 2 cut(s) 213, 450
AluI AGCT 2 cut(s) 213, 450
Alw26I GTCTC 1 cut(s) 438
AlwI GGATC 2 cut(s) 215, 399
AoxI GGCC 2 cut(s) 101, 142
ApoI RAATTY 1 cut(s) 327
Asp700I GAANNNNTTC 1 cut(s) 329
AspS9I GGNCC 3 cut(s) 69, 135, 392
AvaII GGWCC 3 cut(s) 69, 135, 392
BbsI GAAGAC 3 cut(s) 255, 280, 333
BccI CCATC 3 cut(s) 123, 383, 434
BcgI CGANNNNNNTGC 2 cut(s) 4, 38
BcoDI GTCTC 1 cut(s) 438
Bme18I GGWCC 3 cut(s) 69, 135, 392
BmgT120I GGNCC 3 cut(s) 69, 135, 392
BpiI GAAGAC 3 cut(s) 255, 280, 333
BpmI CTGGAG 2 cut(s) 131, 403
Bsa29I ATCGAT 1 cut(s) 403
BsaJI CCNNGG 1 cut(s) 312
Bse1I ACTGG 1 cut(s) 148
BseCI ATCGAT 1 cut(s) 403
BseDI CCNNGG 1 cut(s) 312
BseGI GGATG 1 cut(s) 445
BseMII CTCAG 1 cut(s) 244
BseNI ACTGG 1 cut(s) 148
BshFI GGCC 2 cut(s) 103, 144
BshVI ATCGAT 1 cut(s) 403
BsmAI GTCTC 1 cut(s) 438
BsnI GGCC 2 cut(s) 103, 144
Bsp1407I TGTACA 1 cut(s) 192
Bsp143I GATC 2 cut(s) 207, 404
Bsp19I CCATGG 1 cut(s) 312
BspACI CCGC 1 cut(s) 133
BspANI GGCC 2 cut(s) 103, 144
BspCNI CTCAG 1 cut(s) 245
BspDI ATCGAT 1 cut(s) 403
BspHI TCATGA 1 cut(s) 175
BspPI GGATC 2 cut(s) 215, 399
BsrGI TGTACA 1 cut(s) 192
BsrI ACTGG 1 cut(s) 148
BssECI CCNNGG 1 cut(s) 312
BssMI GATC 2 cut(s) 207, 404
BssT1I CCWWGG 1 cut(s) 312
Bst4CI ACNGT 1 cut(s) 413
BstAUI TGTACA 1 cut(s) 192
BstDEI CTNAG 3 cut(s) 105, 253, 451
BstDSI CCRYGG 1 cut(s) 312
BstF5I GGATG 1 cut(s) 445
BstKTI GATC 2 cut(s) 210, 407
BstMAI GTCTC 1 cut(s) 438
BstMBI GATC 2 cut(s) 207, 404
BstNSI RCATGY 1 cut(s) 350
BstV2I GAAGAC 3 cut(s) 255, 280, 333
Bsu15I ATCGAT 1 cut(s) 403
BsuRI GGCC 2 cut(s) 103, 144
BsuTUI ATCGAT 1 cut(s) 403
BtgI CCRYGG 1 cut(s) 312
BtsCI GGATG 1 cut(s) 445
CciI TCATGA 1 cut(s) 175
Cfr13I GGNCC 3 cut(s) 69, 135, 392
ClaI ATCGAT 1 cut(s) 403
Csp6I GTAC 1 cut(s) 193
CviAII CATG 3 cut(s) 176, 313, 347
CviJI RGCY 6 cut(s) 103, 111, 144, 213, 321, 450
CviKI_1 RGCY 6 cut(s) 103, 111, 144, 213, 321, 450
CviQI GTAC 1 cut(s) 193
DdeI CTNAG 3 cut(s) 105, 253, 451
DpnI GATC 2 cut(s) 209, 406
DpnII GATC 2 cut(s) 207, 404
Eco130I CCWWGG 1 cut(s) 312
Eco47I GGWCC 3 cut(s) 69, 135, 392
EcoT14I CCWWGG 1 cut(s) 312
ErhI CCWWGG 1 cut(s) 312
FaeI CATG 3 cut(s) 179, 316, 350
FatI CATG 3 cut(s) 175, 312, 346
GsuI CTGGAG 2 cut(s) 131, 403
HaeIII GGCC 2 cut(s) 103, 144
Hin1II CATG 3 cut(s) 179, 316, 350
HinfI GANTC 3 cut(s) 249, 338, 417
Hpy166II GTNNAC 1 cut(s) 120
Hpy188I TCNGA 2 cut(s) 254, 362
Hpy188III TCNNGA 3 cut(s) 176, 244, 382
Hpy8I GTNNAC 1 cut(s) 120
HpyAV CCTTC 1 cut(s) 311
HpyCH4III ACNGT 1 cut(s) 413
HpyCH4V TGCA 2 cut(s) 25, 164
HpyF3I CTNAG 3 cut(s) 105, 253, 451
Hsp92II CATG 3 cut(s) 179, 316, 350
Kzo9I GATC 2 cut(s) 207, 404
LpnPI CCDG 5 cut(s) 138, 151, 161, 307, 367
MalI GATC 2 cut(s) 209, 406
MboI GATC 2 cut(s) 207, 404
MboII GAAGA 3 cut(s) 255, 285, 333
MluCI AATT 6 cut(s) 35, 40, 50, 202, 290, 327
MlyI GAGTC 1 cut(s) 347
MmeI TCCRAC 1 cut(s) 432
MnlI CCTC 3 cut(s) 21, 155, 297
MroXI GAANNNNTTC 1 cut(s) 329
MseI TTAA 1 cut(s) 289
NcoI CCATGG 1 cut(s) 312
NdeII GATC 2 cut(s) 207, 404
NlaIII CATG 3 cut(s) 179, 316, 350
NspI RCATGY 1 cut(s) 350
PagI TCATGA 1 cut(s) 175
PdmI GAANNNNTTC 1 cut(s) 329
PfeI GAWTC 2 cut(s) 249, 417
PleI GAGTC 1 cut(s) 346
PpsI GAGTC 1 cut(s) 346
PspPI GGNCC 3 cut(s) 69, 135, 392
RsaI GTAC 1 cut(s) 194
RsaNI GTAC 1 cut(s) 193
SaqAI TTAA 1 cut(s) 289
Sau3AI GATC 2 cut(s) 207, 404
Sau96I GGNCC 3 cut(s) 69, 135, 392
SchI GAGTC 1 cut(s) 347
SetI ASST 3 cut(s) 157, 215, 452
SinI GGWCC 3 cut(s) 69, 135, 392
Sse9I AATT 6 cut(s) 35, 40, 50, 202, 290, 327
SsiI CCGC 1 cut(s) 133
StyI CCWWGG 1 cut(s) 312
TaaI ACNGT 1 cut(s) 413
TaqI TCGA 3 cut(s) 14, 184, 403
TasI AATT 6 cut(s) 35, 40, 50, 202, 290, 327
TatI WGTACW 1 cut(s) 192
TfiI GAWTC 2 cut(s) 249, 417
Tru1I TTAA 1 cut(s) 289
Tru9I TTAA 1 cut(s) 289
TspDTI ATGAA 3 cut(s) 73, 283, 322
VpaK11BI GGWCC 3 cut(s) 69, 135, 392
XapI RAATTY 1 cut(s) 327
XceI RCATGY 1 cut(s) 350
XmnI GAANNNNTTC 1 cut(s) 329
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.