Rmu_co8470117.1_g000001

zinc finger CCCH domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8470117.1
Physical Location & Seq
Reverse (-)
1 .. 1901
1901 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8470117.1_g000001.1.cds

Sequence Viewer

Length: 753 bp
atggtagaaaatttaaaaaagaaggaggaagagaaggcgaaggacaaggaactaaatgagttgtttaaggttgctatcagtcaaccaaaagtaccagttggtgttgatcctaagtctatattatgcgagttttataaagcggggcagtgtgctaaaggtttcaaatgcaagttctcacatgatttgaatgttcagaggaaaggagaaaagattgatctttacagtgataagcgtcaaaatgaaacaatggaggaatgggatcaagaaactttggagaaagttgtggagtcaaagagaaaagagtacaatataaacaagccaactgatattgtttgtaaatactttttggaagcagtggagaaaaaacaatatggttggttttgggtctgccccaatggtggtaaagattgccattacaggcatgctcttcctccaggatatattctgaaatctcagatgaaagctctgttggaggaagagactgaaaagatacctattgaggaggagattgaagatcagcgtgctaagttgaaaacttcgactccaatgactcctgagttgttcatgcaatggaagaagaaaaagatagcagaaagagatgctggcttggcttcaaaaatggcagagcgggctaagaatgaccgtatgagtggtcgtgaactgtttttgtcagattcaaccttatttgtggatgatgctgaggcatctgagaagtatcaaagagagaaggaatctgaagttgctgaaaagaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

251

Amino Acids

29.3

Weight (kDa)

6.87

Isoelectric Point (pI)

41.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 135
AccBSI CCGCTC 1 cut(s) 628
AciI CCGC 2 cut(s) 140, 628
AclWI GGATC 2 cut(s) 101, 267
AcsI RAATTY 1 cut(s) 10
AfaI GTAC 2 cut(s) 93, 305
AfiI CCNNNNNNNGG 1 cut(s) 398
AgsI TTSAA 6 cut(s) 163, 187, 512, 532, 615, 678
AjnI CCWGG 1 cut(s) 433
AjuI GAANNNNNNNTTGG 2 cut(s) 452, 484
AluBI AGCT 1 cut(s) 464
AluI AGCT 1 cut(s) 464
Alw26I GTCTC 1 cut(s) 473
AlwI GGATC 2 cut(s) 101, 267
ApoI RAATTY 1 cut(s) 10
BbvCI CCTCAGC 1 cut(s) 699
BciT130I CCWGG 1 cut(s) 435
BcoDI GTCTC 1 cut(s) 473
Bme1390I CCNGG 1 cut(s) 435
BmrFI CCNGG 1 cut(s) 435
BmsI GCATC 3 cut(s) 589, 685, 713
BpmI CTGGAG 1 cut(s) 417
Bpu10I CCTNAGC 1 cut(s) 699
BsaXI ACNNNNNCTCC 2 cut(s) 526, 556
Bsc4I CCNNNNNNNGG 1 cut(s) 398
Bse1I ACTGG 1 cut(s) 95
Bse3DI GCAATG 1 cut(s) 575
BseBI CCWGG 1 cut(s) 435
BseGI GGATG 1 cut(s) 697
BseLI CCNNNNNNNGG 1 cut(s) 398
BseMI GCAATG 1 cut(s) 575
BseMII CTCAG 4 cut(s) 467, 546, 690, 699
BseNI ACTGG 1 cut(s) 95
BseRI GAGGAG 2 cut(s) 515, 518
BslI CCNNNNNNNGG 1 cut(s) 398
BsmAI GTCTC 1 cut(s) 473
Bsp143I GATC 4 cut(s) 106, 214, 259, 514
BspACI CCGC 2 cut(s) 140, 628
BspCNI CTCAG 4 cut(s) 466, 547, 691, 700
BspPI GGATC 2 cut(s) 101, 267
BspQI GCTCTTC 1 cut(s) 432
BsrBI CCGCTC 1 cut(s) 628
BsrDI GCAATG 1 cut(s) 575
BsrI ACTGG 1 cut(s) 95
BssMI GATC 4 cut(s) 106, 214, 259, 514
Bst2UI CCWGG 1 cut(s) 435
Bst4CI ACNGT 3 cut(s) 224, 644, 663
Bst6I CTCTTC 3 cut(s) 24, 432, 471
BstC8I GCNNGC 4 cut(s) 423, 522, 604, 630
BstDEI CTNAG 7 cut(s) 111, 453, 525, 555, 633, 699, 708
BstF5I GGATG 1 cut(s) 697
BstKTI GATC 4 cut(s) 109, 217, 262, 517
BstMAI GTCTC 1 cut(s) 473
BstMBI GATC 4 cut(s) 106, 214, 259, 514
BstMWI GCNNNNNNNGC 2 cut(s) 608, 629
BstNI CCWGG 1 cut(s) 435
BstNSI RCATGY 1 cut(s) 425
BstSCI CCNGG 1 cut(s) 433
BtsCI GGATG 1 cut(s) 697
BtsI GCAGTG 2 cut(s) 152, 360
BtsIMutI CAGTG 3 cut(s) 152, 229, 360
Cac8I GCNNGC 4 cut(s) 423, 522, 604, 630
CseI GACGC 1 cut(s) 221
Csp6I GTAC 2 cut(s) 92, 304
CviAII CATG 3 cut(s) 179, 422, 565
CviJI RGCY 5 cut(s) 319, 464, 606, 611, 632
CviKI_1 RGCY 5 cut(s) 319, 464, 606, 611, 632
CviQI GTAC 2 cut(s) 92, 304
DdeI CTNAG 7 cut(s) 111, 453, 525, 555, 633, 699, 708
DpnI GATC 4 cut(s) 108, 216, 261, 516
DpnII GATC 4 cut(s) 106, 214, 259, 514
DraI TTTAAA 1 cut(s) 15
Eam1104I CTCTTC 3 cut(s) 24, 432, 471
EarI CTCTTC 3 cut(s) 24, 432, 471
EcoRII CCWGG 1 cut(s) 433
FaeI CATG 3 cut(s) 182, 425, 568
FatI CATG 3 cut(s) 178, 421, 564
FauI CCCGC 2 cut(s) 133, 621
FokI GGATG 1 cut(s) 704
GsuI CTGGAG 1 cut(s) 417
HgaI GACGC 1 cut(s) 221
Hin1II CATG 3 cut(s) 182, 425, 568
HincII GTYRAC 1 cut(s) 83
HindII GTYRAC 1 cut(s) 83
HinfI GANTC 5 cut(s) 287, 541, 550, 674, 731
Hpy166II GTNNAC 2 cut(s) 83, 659
Hpy188I TCNGA 6 cut(s) 195, 447, 456, 673, 709, 736
Hpy188III TCNNGA 3 cut(s) 263, 554, 656
Hpy8I GTNNAC 2 cut(s) 83, 659
HpyAV CCTTC 4 cut(s) 16, 28, 34, 721
HpyCH4III ACNGT 3 cut(s) 224, 644, 663
HpyCH4V TGCA 2 cut(s) 168, 568
HpyF10VI GCNNNNNNNGC 2 cut(s) 608, 629
HpyF3I CTNAG 7 cut(s) 111, 453, 525, 555, 633, 699, 708
Hsp92II CATG 3 cut(s) 182, 425, 568
Kzo9I GATC 4 cut(s) 106, 214, 259, 514
LguI GCTCTTC 1 cut(s) 432
LpnPI CCDG 6 cut(s) 108, 403, 420, 447, 567, 588
LweI GCATC 3 cut(s) 589, 685, 713
MalI GATC 4 cut(s) 108, 216, 261, 516
MbiI CCGCTC 1 cut(s) 628
MboI GATC 4 cut(s) 106, 214, 259, 514
MboII GAAGA 6 cut(s) 41, 419, 488, 524, 586, 589
MluCI AATT 1 cut(s) 10
MlyI GAGTC 3 cut(s) 296, 535, 544
MmeI TCCRAC 1 cut(s) 450
MnlI CCTC 8 cut(s) 19, 189, 244, 441, 466, 493, 496, 694
MseI TTAA 2 cut(s) 14, 66
MspR9I CCNGG 1 cut(s) 435
MvaI CCWGG 1 cut(s) 435
MwoI GCNNNNNNNGC 2 cut(s) 608, 629
NdeII GATC 4 cut(s) 106, 214, 259, 514
NlaIII CATG 3 cut(s) 182, 425, 568
NspI RCATGY 1 cut(s) 425
PaeI GCATGC 1 cut(s) 425
PciSI GCTCTTC 1 cut(s) 432
PfeI GAWTC 2 cut(s) 674, 731
PfoI TCCNGGA 1 cut(s) 433
PleI GAGTC 3 cut(s) 295, 535, 544
PpsI GAGTC 3 cut(s) 295, 535, 544
PsiI TTATAA 1 cut(s) 135
Psp6I CCWGG 1 cut(s) 433
PspGI CCWGG 1 cut(s) 433
RsaI GTAC 2 cut(s) 93, 305
RsaNI GTAC 2 cut(s) 92, 304
SapI GCTCTTC 1 cut(s) 432
SaqAI TTAA 2 cut(s) 14, 66
Sau3AI GATC 4 cut(s) 106, 214, 259, 514
SchI GAGTC 3 cut(s) 296, 535, 544
ScrFI CCNGG 1 cut(s) 435
SetI ASST 5 cut(s) 72, 160, 466, 496, 683
SfaNI GCATC 3 cut(s) 589, 685, 713
SphI GCATGC 1 cut(s) 425
Sse9I AATT 1 cut(s) 10
SsiI CCGC 2 cut(s) 140, 628
StyD4I CCNGG 1 cut(s) 433
TaaI ACNGT 3 cut(s) 224, 644, 663
TaqI TCGA 1 cut(s) 539
TasI AATT 1 cut(s) 10
TatI WGTACW 1 cut(s) 303
TfiI GAWTC 2 cut(s) 674, 731
Tru1I TTAA 2 cut(s) 14, 66
Tru9I TTAA 2 cut(s) 14, 66
TscAI CASTG 3 cut(s) 152, 229, 360
TspDTI ATGAA 3 cut(s) 255, 473, 553
TspRI CASTG 3 cut(s) 152, 229, 360
XapI RAATTY 1 cut(s) 10
XceI RCATGY 1 cut(s) 425
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.