Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000186.1

Orthogroup ID

OG0005896

Physical Location & Seq

Genomic Coordinates Forward (+)

27805 .. 28689

Gene Structure 885 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000186.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 567 bp

atgtcggacttcatccccgacgaggactacaatctcgagtttgatgacgaggaggacgctattgttgcttttgatttggagtcggaggagtttcggagactgcggcttccgtttcctaaggttgaaggagatgacagcgtgaatttcagcgttgcgattttttgcagtgaagggtgtctgtgtccgtggcgttatggaaggcttgctgcttctggctctgttgctttttgggtcatggaaaggtatggagacaatgactcgtggaacatgcgctatagctttaggatttccaatgagactccgattaagtatctcaagccacttatagttacggagagtagtcaagttctggtgagatgttctactgctgcagagctggagttggtgaggattcgtcgacaagaagaggaggagcgtgtcacctatatgaacgagtggccgagcgaatgttatggaaatgaatgtatcacgattttatatgaccacagtttactttcgcttggaatggggggagagattgaaagtccggaaatccacgacaaaggccgcctcgcagagtgcaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box

Protein Analysis

188

Amino Acids

21.77

Weight (kDa)

4.41

Isoelectric Point (pI)

60.31

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005896)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g18410 FvH4_1g18410
rosa_chinensis	RchiOBHm_Chr2g0109111
rosa_laevigata	RLG00000008160 RLG00000008316 RLG00000008418 RLG00000009006 RLG00000012163 RLG00000021316 RLG00000027390 RLG00000032253 RLG00000033851
rosa_multiflora	Rmu_sc0000186.1_g000009 Rmu_sc0000363.1_g000034 Rmu_sc0000820.1_g000019 Rmu_sc0006431.1_g000002 Rmu_sc0010364.1_g000003 Rmu_sc0023232.1_g000001 Rmu_ssc0000114.1_g000057
rosa_roxburghii	Rroxscaffold_2G00092820 Rroxscaffold_7G00189280
rosa_samantha	Rh2AG209000 Rh2AG289900 Rh2AG384200 Rh2BG219400 Rh4DG149700 Rh6AG171600 Rh7DG394000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	397
AccIII	TCCGGA	1 cut(s)	526
AciI	CCGC	2 cut(s)	103, 547
AcoI	YGGCCR	1 cut(s)	437
AcsI	RAATTY	1 cut(s)	142
AfiI	CCNNNNNNNGG	1 cut(s)	22
AgsI	TTSAA	2 cut(s)	125, 521
AluBI	AGCT	2 cut(s)	279, 376
AluI	AGCT	2 cut(s)	279, 376
Alw26I	GTCTC	3 cut(s)	91, 243, 290
Ama87I	CYCGRG	1 cut(s)	35
Aor13HI	TCCGGA	1 cut(s)	526
AoxI	GGCC	2 cut(s)	437, 544
ApeKI	GCWGC	2 cut(s)	206, 368
ApoI	RAATTY	1 cut(s)	142
AspLEI	GCGC	1 cut(s)	273
AsuHPI	GGTGA	3 cut(s)	364, 397, 412
AvaI	CYCGRG	1 cut(s)	35
AxyI	CCTNAGG	1 cut(s)	117
BauI	CACGAG	1 cut(s)	259
BbvI	GCAGC	2 cut(s)	193, 355
BcoDI	GTCTC	3 cut(s)	91, 243, 290
BfmI	CTRYAG	2 cut(s)	274, 369
BisI	GCNGC	4 cut(s)	104, 207, 369, 547
BlsI	GCNGC	4 cut(s)	105, 208, 370, 548
BmeT110I	CYCGRG	1 cut(s)	35
BpmI	CTGGAG	1 cut(s)	398
BpuEI	CTTGAG	1 cut(s)	299
BsaJI	CCNNGG	1 cut(s)	185
BsaWI	WCCGGW	1 cut(s)	526
Bsc4I	CCNNNNNNNGG	1 cut(s)	22
Bse21I	CCTNAGG	1 cut(s)	117
BseAI	TCCGGA	1 cut(s)	526
BseDI	CCNNGG	1 cut(s)	185
BseGI	GGATG	1 cut(s)	12
BseLI	CCNNNNNNNGG	1 cut(s)	22
BseRI	GAGGAG	4 cut(s)	65, 101, 422, 425
BseXI	GCAGC	2 cut(s)	193, 355
BshFI	GGCC	2 cut(s)	439, 546
BsiHKCI	CYCGRG	1 cut(s)	35
BsiSI	CCGG	1 cut(s)	527
BslI	CCNNNNNNNGG	1 cut(s)	22
BsmAI	GTCTC	3 cut(s)	91, 243, 290
BsnI	GGCC	2 cut(s)	439, 546
BsoBI	CYCGRG	1 cut(s)	35
Bsp13I	TCCGGA	1 cut(s)	526
BspACI	CCGC	2 cut(s)	103, 547
BspANI	GGCC	2 cut(s)	439, 546
BspEI	TCCGGA	1 cut(s)	526
BspMAI	CTGCAG	1 cut(s)	373
BssECI	CCNNGG	1 cut(s)	185
BssSI	CACGAG	1 cut(s)	259
Bst2BI	CACGAG	1 cut(s)	259
Bst4CI	ACNGT	1 cut(s)	488
Bst6I	CTCTTC	1 cut(s)	399
BstC8I	GCNNGC	1 cut(s)	204
BstDEI	CTNAG	1 cut(s)	117
BstDSI	CCRYGG	1 cut(s)	185
BstF5I	GGATG	1 cut(s)	12
BstHHI	GCGC	1 cut(s)	273
BstMAI	GTCTC	3 cut(s)	91, 243, 290
BstMWI	GCNNNNNNNGC	1 cut(s)	65
BstNSI	RCATGY	1 cut(s)	271
BstSFI	CTRYAG	2 cut(s)	274, 369
BstV1I	GCAGC	2 cut(s)	193, 355
Bsu36I	CCTNAGG	1 cut(s)	117
BsuRI	GGCC	2 cut(s)	439, 546
BtgI	CCRYGG	1 cut(s)	185
BtsCI	GGATG	1 cut(s)	12
BtsI	GCAGTG	1 cut(s)	172
BtsIMutI	CAGTG	1 cut(s)	172
Cac8I	GCNNGC	1 cut(s)	204
CfoI	GCGC	1 cut(s)	273
CseI	GACGC	1 cut(s)	65
CviAII	CATG	2 cut(s)	235, 268
CviJI	RGCY	8 cut(s)	106, 202, 216, 279, 319, 376, 439, 546
CviKI_1	RGCY	8 cut(s)	106, 202, 216, 279, 319, 376, 439, 546
DdeI	CTNAG	1 cut(s)	117
EaeI	YGGCCR	1 cut(s)	437
Eam1104I	CTCTTC	1 cut(s)	399
EarI	CTCTTC	1 cut(s)	399
Eco81I	CCTNAGG	1 cut(s)	117
Eco88I	CYCGRG	1 cut(s)	35
FaeI	CATG	2 cut(s)	238, 271
FatI	CATG	2 cut(s)	234, 267
FblI	GTMKAC	1 cut(s)	397
Fnu4HI	GCNGC	4 cut(s)	104, 207, 369, 547
Fsp4HI	GCNGC	4 cut(s)	104, 207, 369, 547
GlaI	GCGC	1 cut(s)	272
GluI	GCNGC	4 cut(s)	104, 207, 369, 547
GsuI	CTGGAG	1 cut(s)	398
HaeIII	GGCC	2 cut(s)	439, 546
HapII	CCGG	1 cut(s)	527
HgaI	GACGC	1 cut(s)	65
HhaI	GCGC	1 cut(s)	273
Hin1II	CATG	2 cut(s)	238, 271
Hin6I	GCGC	1 cut(s)	271
HinP1I	GCGC	1 cut(s)	271
HincII	GTYRAC	1 cut(s)	398
HindII	GTYRAC	1 cut(s)	398
HinfI	GANTC	4 cut(s)	80, 257, 298, 391
HpaII	CCGG	1 cut(s)	527
HphI	GGTGA	3 cut(s)	364, 397, 412
Hpy166II	GTNNAC	2 cut(s)	398, 491
Hpy188I	TCNGA	4 cut(s)	7, 85, 96, 303
Hpy188III	TCNNGA	3 cut(s)	35, 469, 527
Hpy8I	GTNNAC	2 cut(s)	398, 491
Hpy99I	CGWCG	2 cut(s)	23, 399
HpyAV	CCTTC	3 cut(s)	119, 164, 192
HpyCH4III	ACNGT	1 cut(s)	488
HpyCH4V	TGCA	3 cut(s)	165, 371, 561
HpyF10VI	GCNNNNNNNGC	1 cut(s)	65
HpyF3I	CTNAG	1 cut(s)	117
Hsp92II	CATG	2 cut(s)	238, 271
HspAI	GCGC	1 cut(s)	271
Kpn2I	TCCGGA	1 cut(s)	526
LmnI	GCTCC	1 cut(s)	412
LpnPI	CCDG	4 cut(s)	198, 335, 362, 540
Lsp1109I	GCAGC	2 cut(s)	193, 355
MaeIII	GTNAC	2 cut(s)	328, 418
MboII	GAAGA	1 cut(s)	416
MluCI	AATT	1 cut(s)	142
MlyI	GAGTC	3 cut(s)	89, 251, 292
MmeI	TCCRAC	1 cut(s)	63
MnlI	CCTC	8 cut(s)	16, 43, 46, 79, 381, 400, 403, 560
MroI	TCCGGA	1 cut(s)	526
MseI	TTAA	1 cut(s)	306
MslI	CAYNNNNRTG	1 cut(s)	425
MspI	CCGG	1 cut(s)	527
MwoI	GCNNNNNNNGC	1 cut(s)	65
NlaIII	CATG	2 cut(s)	238, 271
NmeAIII	GCCGAG	1 cut(s)	465
NmuCI	GTSAC	1 cut(s)	418
NspI	RCATGY	1 cut(s)	271
PaeR7I	CTCGAG	1 cut(s)	35
PfeI	GAWTC	1 cut(s)	391
PkrI	GCNGC	4 cut(s)	105, 208, 370, 548
PleI	GAGTC	3 cut(s)	88, 251, 292
PpsI	GAGTC	3 cut(s)	88, 251, 292
PstI	CTGCAG	1 cut(s)	373
RseI	CAYNNNNRTG	1 cut(s)	425
SalI	GTCGAC	1 cut(s)	396
SaqAI	TTAA	1 cut(s)	306
SatI	GCNGC	4 cut(s)	104, 207, 369, 547
SchI	GAGTC	3 cut(s)	89, 251, 292
SetI	ASST	5 cut(s)	123, 245, 281, 378, 425
SfcI	CTRYAG	2 cut(s)	274, 369
Sfr274I	CTCGAG	1 cut(s)	35
SlaI	CTCGAG	1 cut(s)	35
SmiMI	CAYNNNNRTG	1 cut(s)	425
SmlI	CTYRAG	2 cut(s)	35, 314
SmoI	CTYRAG	2 cut(s)	35, 314
Sse9I	AATT	1 cut(s)	142
SsiI	CCGC	2 cut(s)	103, 547
TaaI	ACNGT	1 cut(s)	488
TaqI	TCGA	2 cut(s)	36, 397
TasI	AATT	1 cut(s)	142
TauI	GCSGC	2 cut(s)	106, 549
TfiI	GAWTC	1 cut(s)	391
Tru1I	TTAA	1 cut(s)	306
Tru9I	TTAA	1 cut(s)	306
TscAI	CASTG	1 cut(s)	172
TseFI	GTSAC	1 cut(s)	418
TseI	GCWGC	2 cut(s)	206, 368
Tsp45I	GTSAC	1 cut(s)	418
TspDTI	ATGAA	2 cut(s)	443, 474
TspGWI	ACGGA	3 cut(s)	99, 174, 347
TspRI	CASTG	1 cut(s)	172
XapI	RAATTY	1 cut(s)	142
XceI	RCATGY	1 cut(s)	271
XhoI	CTCGAG	1 cut(s)	35
XmiI	GTMKAC	1 cut(s)	397

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.