Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000263.1

Orthogroup ID

OG0003632

Physical Location & Seq

Genomic Coordinates Reverse (-)

50718 .. 51615

Gene Structure 898 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000263.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 273 bp

atgccaatacaggcaaaggttgaaatggttgtgacagaaggagatgaagaagggaagaagactacagcaatggtgagggagattgaggcttctgagcttgttcttggactccataatcacagctttctttacaagttggcaatggcgcaaggcaacaatactgcaaacaacttcatgaattgcagagtcctacccatcaagcaatcatcttcttcacaattgaggatcaacaaggccaatgctcctactgataaaaaagttttcaatacctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Usp

Protein Analysis

90

Amino Acids

9.98

Weight (kDa)

8.85

Isoelectric Point (pI)

47.39

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003632)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G48960
fragaria_vesca	FvH4_5g12810 FvH4_5g12810
malus_domestica	MD06G1209900.v1.1 MD14G1220800.v1.1
prunus_persica	Prupe.5G216100_v2.0.a1
pyrus_communis	pycom06g18750 pycom14g18260 pycom14g18270
rosa_chinensis	RchiOBHm_Chr4g0434591 RchiOBHm_Chr5g0042351 RchiOBHm_Chr7g0184421
rosa_laevigata	RLG00000004976
rosa_multiflora	Rmu_sc0000263.1_g000010 Rmu_sc0004359.1_g000002 Rmu_sc0004836.1_g000007 Rmu_sc0009538.1_g000013
rosa_roxburghii	Rroxscaffold_3G00269630
rosa_rugosa	Rorug05G0114200
rosa_samantha	Rh1BG143000 Rh1BG224900 Rh1CG156500 Rh1CG168200 Rh1CG183200 Rh1DG252700 Rh4CG294500 Rh5AG209900 Rh5AG439700 Rh5DG299900 Rh7AG080100 Rh7BG067100 Rh7CG067400 Rh7DG067100
rosa_wichuraiana	Rw5G019120 Rw7G005520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	233
AgsI	TTSAA	2 cut(s)	23, 265
AluBI	AGCT	2 cut(s)	97, 123
AluI	AGCT	2 cut(s)	97, 123
AlwI	GGATC	1 cut(s)	233
AoxI	GGCC	1 cut(s)	234
AspLEI	GCGC	1 cut(s)	148
AsuHPI	GGTGA	1 cut(s)	85
BbsI	GAAGAC	1 cut(s)	65
BccI	CCATC	1 cut(s)	203
BfmI	CTRYAG	1 cut(s)	63
BpiI	GAAGAC	1 cut(s)	65
Bse3DI	GCAATG	2 cut(s)	75, 147
BseMI	GCAATG	2 cut(s)	75, 147
BseMII	CTCAG	1 cut(s)	84
BshFI	GGCC	1 cut(s)	236
BsnI	GGCC	1 cut(s)	236
Bsp143I	GATC	1 cut(s)	225
BspANI	GGCC	1 cut(s)	236
BspCNI	CTCAG	1 cut(s)	85
BspHI	TCATGA	1 cut(s)	174
BspPI	GGATC	1 cut(s)	233
BsrDI	GCAATG	2 cut(s)	75, 147
BssMI	GATC	1 cut(s)	225
BstDEI	CTNAG	1 cut(s)	93
BstHHI	GCGC	1 cut(s)	148
BstKTI	GATC	1 cut(s)	228
BstMBI	GATC	1 cut(s)	225
BstSFI	CTRYAG	1 cut(s)	63
BstV2I	GAAGAC	1 cut(s)	65
BsuRI	GGCC	1 cut(s)	236
CciI	TCATGA	1 cut(s)	174
CfoI	GCGC	1 cut(s)	148
CviAII	CATG	1 cut(s)	175
CviJI	RGCY	4 cut(s)	89, 97, 123, 236
CviKI_1	RGCY	4 cut(s)	89, 97, 123, 236
DdeI	CTNAG	1 cut(s)	93
DpnI	GATC	1 cut(s)	227
DpnII	GATC	1 cut(s)	225
FaeI	CATG	1 cut(s)	178
FaiI	YATR	2 cut(s)	114, 176
FatI	CATG	1 cut(s)	174
GlaI	GCGC	1 cut(s)	147
HaeIII	GGCC	1 cut(s)	236
HhaI	GCGC	1 cut(s)	148
Hin1II	CATG	1 cut(s)	178
Hin6I	GCGC	1 cut(s)	146
HinP1I	GCGC	1 cut(s)	146
HinfI	GANTC	2 cut(s)	108, 186
HphI	GGTGA	1 cut(s)	85
Hpy188I	TCNGA	1 cut(s)	94
Hpy188III	TCNNGA	1 cut(s)	175
HpyAV	CCTTC	2 cut(s)	32, 44
HpyCH4V	TGCA	2 cut(s)	164, 183
HpyF3I	CTNAG	1 cut(s)	93
Hsp92II	CATG	1 cut(s)	178
HspAI	GCGC	1 cut(s)	146
Kzo9I	GATC	1 cut(s)	225
LmnI	GCTCC	1 cut(s)	247
MaeIII	GTNAC	1 cut(s)	31
MalI	GATC	1 cut(s)	227
MboI	GATC	1 cut(s)	225
MboII	GAAGA	5 cut(s)	59, 67, 70, 201, 204
MfeI	CAATTG	1 cut(s)	218
MluCI	AATT	2 cut(s)	178, 218
MlyI	GAGTC	2 cut(s)	102, 195
MnlI	CCTC	3 cut(s)	69, 79, 216
MunI	CAATTG	1 cut(s)	218
NdeII	GATC	1 cut(s)	225
NlaIII	CATG	1 cut(s)	178
NmuCI	GTSAC	1 cut(s)	31
PagI	TCATGA	1 cut(s)	174
PleI	GAGTC	2 cut(s)	102, 194
PpsI	GAGTC	2 cut(s)	102, 194
Sau3AI	GATC	1 cut(s)	225
SchI	GAGTC	2 cut(s)	102, 195
SetI	ASST	4 cut(s)	21, 99, 125, 272
SfcI	CTRYAG	1 cut(s)	63
SgeI	CNNG	8 cut(s)	23, 110, 116, 145, 161, 187, 211, 244
Sse9I	AATT	2 cut(s)	178, 218
TasI	AATT	2 cut(s)	178, 218
TseFI	GTSAC	1 cut(s)	31
Tsp45I	GTSAC	1 cut(s)	31
TspDTI	ATGAA	3 cut(s)	60, 163, 191

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.