Rmu_sc0009538.1_g000013

Universal stress protein family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009538.1
Physical Location & Seq
Reverse (-)
80252 .. 81149
898 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009538.1_g000013.1.cds

Sequence Viewer

Length: 273 bp
atgccaatacaggcaaaggttgaaatggttgtgacagaaggagatgaagaagggaagaagactacagcaatggtgagggagattgaggcttctgagcttgttcttggactccataatcacagctttctttacaagttggcaatggcgcaaggcaacaatactgcaaacaacttcatgaattgcagagtcctacccatcaagcaatcatcttcttcacaattgaggatcaacaaggccaatgctcctactgataaaaaagttttcaatacctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

9.98

Weight (kDa)

8.85

Isoelectric Point (pI)

47.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 233
AgsI TTSAA 2 cut(s) 23, 265
AluBI AGCT 2 cut(s) 97, 123
AluI AGCT 2 cut(s) 97, 123
AlwI GGATC 1 cut(s) 233
AoxI GGCC 1 cut(s) 234
AspLEI GCGC 1 cut(s) 148
AsuHPI GGTGA 1 cut(s) 85
BbsI GAAGAC 1 cut(s) 65
BccI CCATC 1 cut(s) 203
BfmI CTRYAG 1 cut(s) 63
BpiI GAAGAC 1 cut(s) 65
Bse3DI GCAATG 2 cut(s) 75, 147
BseMI GCAATG 2 cut(s) 75, 147
BseMII CTCAG 1 cut(s) 84
BshFI GGCC 1 cut(s) 236
BsnI GGCC 1 cut(s) 236
Bsp143I GATC 1 cut(s) 225
BspANI GGCC 1 cut(s) 236
BspCNI CTCAG 1 cut(s) 85
BspHI TCATGA 1 cut(s) 174
BspPI GGATC 1 cut(s) 233
BsrDI GCAATG 2 cut(s) 75, 147
BssMI GATC 1 cut(s) 225
BstDEI CTNAG 1 cut(s) 93
BstHHI GCGC 1 cut(s) 148
BstKTI GATC 1 cut(s) 228
BstMBI GATC 1 cut(s) 225
BstSFI CTRYAG 1 cut(s) 63
BstV2I GAAGAC 1 cut(s) 65
BsuRI GGCC 1 cut(s) 236
CciI TCATGA 1 cut(s) 174
CfoI GCGC 1 cut(s) 148
CviAII CATG 1 cut(s) 175
CviJI RGCY 4 cut(s) 89, 97, 123, 236
CviKI_1 RGCY 4 cut(s) 89, 97, 123, 236
DdeI CTNAG 1 cut(s) 93
DpnI GATC 1 cut(s) 227
DpnII GATC 1 cut(s) 225
FaeI CATG 1 cut(s) 178
FaiI YATR 2 cut(s) 114, 176
FatI CATG 1 cut(s) 174
GlaI GCGC 1 cut(s) 147
HaeIII GGCC 1 cut(s) 236
HhaI GCGC 1 cut(s) 148
Hin1II CATG 1 cut(s) 178
Hin6I GCGC 1 cut(s) 146
HinP1I GCGC 1 cut(s) 146
HinfI GANTC 2 cut(s) 108, 186
HphI GGTGA 1 cut(s) 85
Hpy188I TCNGA 1 cut(s) 94
Hpy188III TCNNGA 1 cut(s) 175
HpyAV CCTTC 2 cut(s) 32, 44
HpyCH4V TGCA 2 cut(s) 164, 183
HpyF3I CTNAG 1 cut(s) 93
Hsp92II CATG 1 cut(s) 178
HspAI GCGC 1 cut(s) 146
Kzo9I GATC 1 cut(s) 225
LmnI GCTCC 1 cut(s) 247
MaeIII GTNAC 1 cut(s) 31
MalI GATC 1 cut(s) 227
MboI GATC 1 cut(s) 225
MboII GAAGA 5 cut(s) 59, 67, 70, 201, 204
MfeI CAATTG 1 cut(s) 218
MluCI AATT 2 cut(s) 178, 218
MlyI GAGTC 2 cut(s) 102, 195
MnlI CCTC 3 cut(s) 69, 79, 216
MunI CAATTG 1 cut(s) 218
NdeII GATC 1 cut(s) 225
NlaIII CATG 1 cut(s) 178
NmuCI GTSAC 1 cut(s) 31
PagI TCATGA 1 cut(s) 174
PleI GAGTC 2 cut(s) 102, 194
PpsI GAGTC 2 cut(s) 102, 194
Sau3AI GATC 1 cut(s) 225
SchI GAGTC 2 cut(s) 102, 195
SetI ASST 4 cut(s) 21, 99, 125, 272
SfcI CTRYAG 1 cut(s) 63
SgeI CNNG 8 cut(s) 23, 110, 116, 145, 161, 187, 211, 244
Sse9I AATT 2 cut(s) 178, 218
TasI AATT 2 cut(s) 178, 218
TseFI GTSAC 1 cut(s) 31
Tsp45I GTSAC 1 cut(s) 31
TspDTI ATGAA 3 cut(s) 60, 163, 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.