Rh1BG143000

Universal stress protein family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
23730292 .. 23733465
3174 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG143000.1

Sequence Viewer

Length: 249 bp
ATGGTTGTGACAGAAGGAGATGAAGAAGGGAAGAAGACTACAGCAATGGTGAGGGAGATTGAGGCTTCTGAGCTTGTTCTTGGACTCCATAATCACAGCTTTCTTTACAAGTTGGCAATGGCGCAAGGCAACAATACTGCAAACAACTTCATGAATTGCAGAGTCCTACCCATCAAGCAATCATCTTCTTCACAATTGAGGATCAACAAGGCCAATGCTCCTACTGATAAAAAAGTTTTCAATACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.08

Weight (kDa)

8.89

Isoelectric Point (pI)

46.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 209
AgsI TTSAA 1 cut(s) 241
AluBI AGCT 2 cut(s) 73, 99
AluI AGCT 2 cut(s) 73, 99
AlwI GGATC 1 cut(s) 209
AoxI GGCC 1 cut(s) 210
AspLEI GCGC 1 cut(s) 124
AsuHPI GGTGA 1 cut(s) 61
BbsI GAAGAC 1 cut(s) 41
BccI CCATC 1 cut(s) 179
BfmI CTRYAG 1 cut(s) 39
BpiI GAAGAC 1 cut(s) 41
Bse3DI GCAATG 2 cut(s) 51, 123
BseMI GCAATG 2 cut(s) 51, 123
BseMII CTCAG 1 cut(s) 60
BshFI GGCC 1 cut(s) 212
BsnI GGCC 1 cut(s) 212
Bsp143I GATC 1 cut(s) 201
BspANI GGCC 1 cut(s) 212
BspCNI CTCAG 1 cut(s) 61
BspHI TCATGA 1 cut(s) 150
BspPI GGATC 1 cut(s) 209
BsrDI GCAATG 2 cut(s) 51, 123
BssMI GATC 1 cut(s) 201
BstDEI CTNAG 1 cut(s) 69
BstHHI GCGC 1 cut(s) 124
BstKTI GATC 1 cut(s) 204
BstMBI GATC 1 cut(s) 201
BstSFI CTRYAG 1 cut(s) 39
BstV2I GAAGAC 1 cut(s) 41
BsuRI GGCC 1 cut(s) 212
CciI TCATGA 1 cut(s) 150
CfoI GCGC 1 cut(s) 124
CviAII CATG 1 cut(s) 151
CviJI RGCY 4 cut(s) 65, 73, 99, 212
CviKI_1 RGCY 4 cut(s) 65, 73, 99, 212
DdeI CTNAG 1 cut(s) 69
DpnI GATC 1 cut(s) 203
DpnII GATC 1 cut(s) 201
FaeI CATG 1 cut(s) 154
FaiI YATR 2 cut(s) 90, 152
FatI CATG 1 cut(s) 150
GlaI GCGC 1 cut(s) 123
HaeIII GGCC 1 cut(s) 212
HhaI GCGC 1 cut(s) 124
Hin1II CATG 1 cut(s) 154
Hin6I GCGC 1 cut(s) 122
HinP1I GCGC 1 cut(s) 122
HinfI GANTC 2 cut(s) 84, 162
HphI GGTGA 1 cut(s) 61
Hpy188I TCNGA 1 cut(s) 70
Hpy188III TCNNGA 1 cut(s) 151
HpyAV CCTTC 2 cut(s) 8, 20
HpyCH4V TGCA 2 cut(s) 140, 159
HpyF3I CTNAG 1 cut(s) 69
Hsp92II CATG 1 cut(s) 154
HspAI GCGC 1 cut(s) 122
Kzo9I GATC 1 cut(s) 201
LmnI GCTCC 1 cut(s) 223
MaeIII GTNAC 1 cut(s) 7
MalI GATC 1 cut(s) 203
MboI GATC 1 cut(s) 201
MboII GAAGA 5 cut(s) 35, 43, 46, 177, 180
MfeI CAATTG 1 cut(s) 194
MluCI AATT 2 cut(s) 154, 194
MlyI GAGTC 2 cut(s) 78, 171
MnlI CCTC 3 cut(s) 45, 55, 192
MunI CAATTG 1 cut(s) 194
NdeII GATC 1 cut(s) 201
NlaIII CATG 1 cut(s) 154
NmuCI GTSAC 1 cut(s) 7
PagI TCATGA 1 cut(s) 150
PleI GAGTC 2 cut(s) 78, 170
PpsI GAGTC 2 cut(s) 78, 170
Sau3AI GATC 1 cut(s) 201
SchI GAGTC 2 cut(s) 78, 171
SetI ASST 3 cut(s) 75, 101, 248
SfcI CTRYAG 1 cut(s) 39
SgeI CNNG 7 cut(s) 86, 92, 121, 137, 163, 187, 220
Sse9I AATT 2 cut(s) 154, 194
TasI AATT 2 cut(s) 154, 194
TseFI GTSAC 1 cut(s) 7
Tsp45I GTSAC 1 cut(s) 7
TspDTI ATGAA 3 cut(s) 36, 139, 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.