Rh4CG294500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
55374683 .. 55374964
282 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG294500.1

Sequence Viewer

Length: 192 bp
ATGTGCCTCCCTCTCCTCTCCTCCTCTCCATTCTCCTTGGACTGCACAAACACACATGCATTAGGCTTGCTTTGTGTTTGTGACTCTTTGCTTGGAGTTTTCCAACAACAGAGGATTTTGGCAATGGGGTTGATTTGGGTGTGTGGGAATAGCCTCATTTCCAAGCTGGGTCTTTCAGTGAACGAGATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

6.74

Weight (kDa)

5.36

Isoelectric Point (pI)

46.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
BfaI CTAG 1 cut(s) 190
BglII AGATCT 1 cut(s) 186
BsaJI CCNNGG 1 cut(s) 36
Bse3DI GCAATG 1 cut(s) 129
BseDI CCNNGG 1 cut(s) 36
BseMI GCAATG 1 cut(s) 129
BseRI GAGGAG 3 cut(s) 5, 10, 13
BseYI CCCAGC 1 cut(s) 166
BsgI GTGCAG 1 cut(s) 28
Bsp143I GATC 1 cut(s) 186
BsrDI GCAATG 1 cut(s) 129
BssECI CCNNGG 1 cut(s) 36
BssMI GATC 1 cut(s) 186
BssT1I CCWWGG 1 cut(s) 36
BstC8I GCNNGC 1 cut(s) 68
BstKTI GATC 1 cut(s) 189
BstMBI GATC 1 cut(s) 186
BstNSI RCATGY 1 cut(s) 59
BstX2I RGATCY 1 cut(s) 186
BstYI RGATCY 1 cut(s) 186
BtsIMutI CAGTG 1 cut(s) 183
Cac8I GCNNGC 1 cut(s) 68
CviAII CATG 1 cut(s) 56
CviJI RGCY 3 cut(s) 66, 153, 166
CviKI_1 RGCY 3 cut(s) 66, 153, 166
DpnI GATC 1 cut(s) 188
DpnII GATC 1 cut(s) 186
Eco130I CCWWGG 1 cut(s) 36
EcoT14I CCWWGG 1 cut(s) 36
EcoT22I ATGCAT 1 cut(s) 61
ErhI CCWWGG 1 cut(s) 36
FaeI CATG 1 cut(s) 59
FaiI YATR 1 cut(s) 57
FatI CATG 1 cut(s) 55
FspBI CTAG 1 cut(s) 190
GsaI CCCAGC 1 cut(s) 170
Hin1II CATG 1 cut(s) 59
HinfI GANTC 1 cut(s) 83
Hpy166II GTNNAC 1 cut(s) 181
Hpy8I GTNNAC 1 cut(s) 181
HpyCH4V TGCA 2 cut(s) 45, 59
Hsp92II CATG 1 cut(s) 59
Kzo9I GATC 1 cut(s) 186
LpnPI CCDG 1 cut(s) 152
MaeI CTAG 1 cut(s) 190
MaeIII GTNAC 1 cut(s) 80
MalI GATC 1 cut(s) 188
MboI GATC 1 cut(s) 186
MflI RGATCY 1 cut(s) 186
MlyI GAGTC 1 cut(s) 77
MmeI TCCRAC 1 cut(s) 127
MnlI CCTC 7 cut(s) 17, 21, 26, 31, 34, 105, 164
Mph1103I ATGCAT 1 cut(s) 61
NdeII GATC 1 cut(s) 186
NlaIII CATG 1 cut(s) 59
NmuCI GTSAC 1 cut(s) 80
NsiI ATGCAT 1 cut(s) 61
NspI RCATGY 1 cut(s) 59
PleI GAGTC 1 cut(s) 77
PpsI GAGTC 1 cut(s) 77
PspFI CCCAGC 1 cut(s) 166
PsuI RGATCY 1 cut(s) 186
Sau3AI GATC 1 cut(s) 186
SchI GAGTC 1 cut(s) 77
SetI ASST 1 cut(s) 168
SgeI CNNG 6 cut(s) 49, 68, 79, 104, 175, 179
SspMI CTAG 1 cut(s) 190
StyI CCWWGG 1 cut(s) 36
TscAI CASTG 1 cut(s) 183
TseFI GTSAC 1 cut(s) 80
Tsp45I GTSAC 1 cut(s) 80
TspRI CASTG 1 cut(s) 183
XceI RCATGY 1 cut(s) 59
XspI CTAG 1 cut(s) 190
Zsp2I ATGCAT 1 cut(s) 61
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.