Rh1CG156500

Universal stress protein family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0003632
Physical Location & Seq
Forward (+)
34657624 .. 34658185
562 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG156500.1

Sequence Viewer

Length: 201 bp
ATGGGGTTGATTTGGGTGTGTGGGAACAGCCTCATTTCCAAGTTGGGGTTTTTCTGGGTTCTTTCAGTAAAAGAGATAAGGTTGGCAATGGCCCAAGGCAGCAATACTGCAAACAACTTCATGAATTGCAGAGTCCTAGCCATCAAGCAACCATCTTCTTCACCATTGAGGATCAACAAGGCTAGTGCTTCTACTGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Usp

Protein Analysis

66

Amino Acids

7.19

Weight (kDa)

10.06

Isoelectric Point (pI)

32.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 179
AfiI CCNNNNNNNGG 1 cut(s) 45
AlwI GGATC 1 cut(s) 179
AoxI GGCC 1 cut(s) 90
ApeKI GCWGC 1 cut(s) 99
AspS9I GGNCC 1 cut(s) 91
AsuHPI GGTGA 1 cut(s) 153
BbvI GCAGC 1 cut(s) 111
BccI CCATC 2 cut(s) 149, 160
BfaI CTAG 2 cut(s) 137, 183
BisI GCNGC 1 cut(s) 100
BlsI GCNGC 1 cut(s) 101
BmgT120I GGNCC 1 cut(s) 91
BsaJI CCNNGG 1 cut(s) 94
Bsc4I CCNNNNNNNGG 1 cut(s) 45
Bse3DI GCAATG 1 cut(s) 93
BseDI CCNNGG 1 cut(s) 94
BseLI CCNNNNNNNGG 1 cut(s) 45
BseMI GCAATG 1 cut(s) 93
BseXI GCAGC 1 cut(s) 111
BshFI GGCC 1 cut(s) 92
BslI CCNNNNNNNGG 1 cut(s) 45
BsnI GGCC 1 cut(s) 92
Bsp143I GATC 1 cut(s) 171
BspANI GGCC 1 cut(s) 92
BspHI TCATGA 1 cut(s) 120
BspPI GGATC 1 cut(s) 179
BsrDI GCAATG 1 cut(s) 93
BssECI CCNNGG 1 cut(s) 94
BssMI GATC 1 cut(s) 171
BssT1I CCWWGG 1 cut(s) 94
BstKTI GATC 1 cut(s) 174
BstMBI GATC 1 cut(s) 171
BstV1I GCAGC 1 cut(s) 111
BsuRI GGCC 1 cut(s) 92
CciI TCATGA 1 cut(s) 120
Cfr13I GGNCC 1 cut(s) 91
CviAII CATG 1 cut(s) 121
CviJI RGCY 4 cut(s) 30, 92, 140, 182
CviKI_1 RGCY 4 cut(s) 30, 92, 140, 182
DpnI GATC 1 cut(s) 173
DpnII GATC 1 cut(s) 171
Eco130I CCWWGG 1 cut(s) 94
EcoT14I CCWWGG 1 cut(s) 94
ErhI CCWWGG 1 cut(s) 94
FaeI CATG 1 cut(s) 124
FaiI YATR 1 cut(s) 122
FatI CATG 1 cut(s) 120
Fnu4HI GCNGC 1 cut(s) 100
Fsp4HI GCNGC 1 cut(s) 100
FspBI CTAG 2 cut(s) 137, 183
GluI GCNGC 1 cut(s) 100
HaeIII GGCC 1 cut(s) 92
Hin1II CATG 1 cut(s) 124
HinfI GANTC 1 cut(s) 132
HphI GGTGA 1 cut(s) 153
Hpy188III TCNNGA 1 cut(s) 121
HpyCH4V TGCA 2 cut(s) 110, 129
Hsp92II CATG 1 cut(s) 124
Kzo9I GATC 1 cut(s) 171
LpnPI CCDG 1 cut(s) 40
Lsp1109I GCAGC 1 cut(s) 111
MaeI CTAG 2 cut(s) 137, 183
MalI GATC 1 cut(s) 173
MboI GATC 1 cut(s) 171
MboII GAAGA 2 cut(s) 147, 150
MluCI AATT 1 cut(s) 124
MlyI GAGTC 1 cut(s) 141
MnlI CCTC 2 cut(s) 41, 162
MseI TTAA 1 cut(s) 199
NdeII GATC 1 cut(s) 171
NlaIII CATG 1 cut(s) 124
PagI TCATGA 1 cut(s) 120
PkrI GCNGC 1 cut(s) 101
PleI GAGTC 1 cut(s) 140
PpsI GAGTC 1 cut(s) 140
PspPI GGNCC 1 cut(s) 91
SaqAI TTAA 1 cut(s) 199
SatI GCNGC 1 cut(s) 100
Sau3AI GATC 1 cut(s) 171
Sau96I GGNCC 1 cut(s) 91
SchI GAGTC 1 cut(s) 141
SetI ASST 1 cut(s) 83
SgeI CNNG 8 cut(s) 52, 67, 107, 133, 149, 157, 190, 195
Sse9I AATT 1 cut(s) 124
SspMI CTAG 2 cut(s) 137, 183
StyI CCWWGG 1 cut(s) 94
TasI AATT 1 cut(s) 124
Tru1I TTAA 1 cut(s) 199
Tru9I TTAA 1 cut(s) 199
TseI GCWGC 1 cut(s) 99
TspDTI ATGAA 2 cut(s) 109, 137
XspI CTAG 2 cut(s) 137, 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.