Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000295.1

Orthogroup ID

OG0005187

Physical Location & Seq

Genomic Coordinates Reverse (-)

28445 .. 28738

Gene Structure 294 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000295.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 294 bp

atggactttcaaagggtattatttgattgtcgatttcttgagttcgctgttgatcttgttttcaagaatattgtgggaatgaaattgttggtcaaactaccatctagtctggacaccactgagattgagggaaaagcagaagataccatccaaagagtaaaaacaatgattcaggctaaggagaagattcaacctgaccaattcacactcgtttgtgatggaaagttccttgaggtggacataacactggcctcagtacatatgaagaatgagttgactctttacatggtttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003774 GO:0003777 GO:0003824 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005856 GO:0005871 GO:0005875 GO:0006810 GO:0006928 GO:0007017 GO:0007018 GO:0008017 GO:0008092 GO:0008150 GO:0008574 GO:0009524 GO:0009987 GO:0010970 GO:0015630 GO:0015631 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0030705 GO:0032991 GO:0042623 GO:0043226 GO:0043228 GO:0043229 GO:0043232 GO:0044422 GO:0044424 GO:0044430 GO:0044444 GO:0044446 GO:0044464 GO:0046907 GO:0047496 GO:0051179 GO:0051234 GO:0051640 GO:0051641 GO:0051648 GO:0051649 GO:0051650 GO:0051656 GO:0072384 GO:0099111 GO:0099518 GO:1990939

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Kinesin

Protein Analysis

97

Amino Acids

11.17

Weight (kDa)

5.06

Isoelectric Point (pI)

23.84

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005187)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g03990 FvH4_4g03992
malus_domestica	MD16G1221600.v1.1
prunus_persica	Prupe.1G041900_v2.0.a1 Prupe.1G042000_v2.0.a1
pyrus_communis	pycom13g18970
rosa_chinensis	RchiOBHm_Chr4g0394221 RchiOBHm_Chr4g0394231 RchiOBHm_Chr4g0394241
rosa_laevigata	RLG00000009712
rosa_multiflora	Rmu_co7959593.1_g000001 Rmu_co8171576.1_g000001 Rmu_sc0000295.1_g000005 Rmu_sc0007246.1_g000006 Rmu_sc0007246.1_g000007 Rmu_sc0024069.1_g000001
rosa_roxburghii	Rroxscaffold_5G00339280 Rroxscaffold_5G00339290
rosa_samantha	Rh4AG050900 Rh4AG051000 Rh4BG047800 Rh4BG047900 Rh4BG048000 Rh4CG054500 Rh4CG054600 Rh4CG054700 Rh4DG047500 Rh4DG047700
rosa_wichuraiana	Rw4G004050 Rw4G004060

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	258
AfiI	CCNNNNNNNGG	1 cut(s)	235
AgsI	TTSAA	3 cut(s)	11, 64, 191
AoxI	GGCC	1 cut(s)	249
BccI	CCATC	3 cut(s)	109, 155, 212
BfaI	CTAG	1 cut(s)	105
Bpu10I	CCTNAGC	1 cut(s)	177
BpuEI	CTTGAG	2 cut(s)	59, 251
Bsc4I	CCNNNNNNNGG	1 cut(s)	235
Bse1I	ACTGG	1 cut(s)	252
BseGI	GGATG	1 cut(s)	147
BseLI	CCNNNNNNNGG	1 cut(s)	235
BseMII	CTCAG	2 cut(s)	111, 267
BseNI	ACTGG	1 cut(s)	252
BshFI	GGCC	1 cut(s)	251
BslI	CCNNNNNNNGG	1 cut(s)	235
BsnI	GGCC	1 cut(s)	251
Bsp143I	GATC	1 cut(s)	52
BspANI	GGCC	1 cut(s)	251
BspCNI	CTCAG	2 cut(s)	112, 266
BsrI	ACTGG	1 cut(s)	252
BssMI	GATC	1 cut(s)	52
BstDEI	CTNAG	3 cut(s)	120, 177, 253
BstF5I	GGATG	1 cut(s)	147
BstKTI	GATC	1 cut(s)	55
BstMBI	GATC	1 cut(s)	52
BsuRI	GGCC	1 cut(s)	251
BtsCI	GGATG	1 cut(s)	147
BtsIMutI	CAGTG	2 cut(s)	117, 245
Csp6I	GTAC	1 cut(s)	257
CspCI	CAANNNNNGTGG	2 cut(s)	106, 141
CviAII	CATG	1 cut(s)	286
CviJI	RGCY	2 cut(s)	176, 251
CviKI_1	RGCY	2 cut(s)	176, 251
CviQI	GTAC	1 cut(s)	257
DdeI	CTNAG	3 cut(s)	120, 177, 253
DpnI	GATC	1 cut(s)	54
DpnII	GATC	1 cut(s)	52
FaeI	CATG	1 cut(s)	289
FaiI	YATR	4 cut(s)	242, 261, 263, 287
FatI	CATG	1 cut(s)	285
FauNDI	CATATG	1 cut(s)	261
FokI	GGATG	1 cut(s)	134
FspBI	CTAG	1 cut(s)	105
HaeIII	GGCC	1 cut(s)	251
Hin1II	CATG	1 cut(s)	289
HincII	GTYRAC	1 cut(s)	276
HindII	GTYRAC	1 cut(s)	276
HinfI	GANTC	3 cut(s)	169, 187, 277
Hpy166II	GTNNAC	2 cut(s)	238, 276
Hpy188III	TCNNGA	3 cut(s)	38, 64, 110
Hpy8I	GTNNAC	2 cut(s)	238, 276
HpyF3I	CTNAG	3 cut(s)	120, 177, 253
Hsp92II	CATG	1 cut(s)	289
Kzo9I	GATC	1 cut(s)	52
LpnPI	CCDG	4 cut(s)	95, 158, 207, 233
MaeI	CTAG	1 cut(s)	105
MalI	GATC	1 cut(s)	54
MboI	GATC	1 cut(s)	52
MboII	GAAGA	3 cut(s)	152, 196, 277
MluCI	AATT	2 cut(s)	83, 200
MlyI	GAGTC	1 cut(s)	271
MnlI	CCTC	3 cut(s)	121, 226, 262
NdeI	CATATG	1 cut(s)	261
NdeII	GATC	1 cut(s)	52
NlaIII	CATG	1 cut(s)	289
PfeI	GAWTC	2 cut(s)	169, 187
PleI	GAGTC	1 cut(s)	271
PpsI	GAGTC	1 cut(s)	271
RsaI	GTAC	1 cut(s)	258
RsaNI	GTAC	1 cut(s)	257
Sau3AI	GATC	1 cut(s)	52
SchI	GAGTC	1 cut(s)	271
SetI	ASST	2 cut(s)	196, 237
SmlI	CTYRAG	2 cut(s)	38, 230
SmoI	CTYRAG	2 cut(s)	38, 230
Sse9I	AATT	2 cut(s)	83, 200
SspI	AATATT	1 cut(s)	70
SspMI	CTAG	1 cut(s)	105
TaqI	TCGA	1 cut(s)	31
TasI	AATT	2 cut(s)	83, 200
TatI	WGTACW	1 cut(s)	256
TfiI	GAWTC	2 cut(s)	169, 187
TscAI	CASTG	2 cut(s)	124, 252
TspDTI	ATGAA	2 cut(s)	95, 278
TspRI	CASTG	2 cut(s)	124, 252
XspI	CTAG	1 cut(s)	105

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.