Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001208.1

Orthogroup ID

OG0005181

Physical Location & Seq

Genomic Coordinates Forward (+)

126252 .. 126679

Gene Structure 428 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001208.1_g000033.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 237 bp

atgagagcttatggaattgaatttaaagaaggcccagatgggtttggagtttatgcttccaaggatgttgaaccacttcgccgtgctagggtgataatggaaataccactagaactgatgttaactataagccaaaagctcccatggatgtttttcccagatatagtaccggtgggtcacccaatatttgatatcatcaattcaacaagaagagaagctatgctcagcttcatttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Rubis-subs-bind SET

Protein Analysis

78

Amino Acids

9.0

Weight (kDa)

5.71

Isoelectric Point (pI)

45.26

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005181)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g13130
malus_domestica	MD05G1244700.v1.1
pyrus_communis	pycom05g22120
rosa_chinensis	RchiOBHm_Chr1g0331441 RchiOBHm_Chr1g0378801 RchiOBHm_Chr2g0167351 RchiOBHm_Chr3g0456081 RchiOBHm_Chr3g0482001 RchiOBHm_Chr5g0063511
rosa_laevigata	RLG00000008600
rosa_multiflora	Rmu_sc0001208.1_g000033
rosa_roxburghii	Rroxscaffold_4G00300020
rosa_rugosa	Rorug02G0631000 Rorug05G0525600 Rorug05G0556200 Rorug06G0064800 Rorug06G0243200 Rorug07G0201200 Rorug07G0222900
rosa_samantha	Rh1BG283100 Rh1DG314900 Rh3AG245400 Rh3DG323100 Rh5BG155400 Rh5DG155900 Rh6BG246300 Rh7DG405100
rosa_wichuraiana	Rw2G025960 Rw4G010270 Rw5G028080

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	20
AfaI	GTAC	1 cut(s)	168
AfiI	CCNNNNNNNGG	1 cut(s)	88
AgeI	ACCGGT	1 cut(s)	169
AgsI	TTSAA	3 cut(s)	20, 71, 204
AluBI	AGCT	4 cut(s)	8, 139, 218, 228
AluI	AGCT	4 cut(s)	8, 139, 218, 228
AoxI	GGCC	1 cut(s)	31
ApoI	RAATTY	1 cut(s)	20
AsiGI	ACCGGT	1 cut(s)	169
Asp700I	GAANNNNTTC	1 cut(s)	75
AspS9I	GGNCC	1 cut(s)	32
AsuHPI	GGTGA	2 cut(s)	103, 170
BccI	CCATC	1 cut(s)	32
BceAI	ACGGC	1 cut(s)	66
BfaI	CTAG	2 cut(s)	87, 110
BlpI	GCTNAGC	1 cut(s)	224
BmgT120I	GGNCC	1 cut(s)	32
Bpu1102I	GCTNAGC	1 cut(s)	224
BsaJI	CCNNGG	2 cut(s)	60, 143
BsaWI	WCCGGW	1 cut(s)	169
Bsc4I	CCNNNNNNNGG	1 cut(s)	88
Bse118I	RCCGGY	1 cut(s)	169
BseDI	CCNNGG	2 cut(s)	60, 143
BseGI	GGATG	2 cut(s)	70, 153
BseLI	CCNNNNNNNGG	1 cut(s)	88
BshFI	GGCC	1 cut(s)	33
BshTI	ACCGGT	1 cut(s)	169
BsiSI	CCGG	1 cut(s)	170
BslI	CCNNNNNNNGG	1 cut(s)	88
BsnI	GGCC	1 cut(s)	33
Bsp1720I	GCTNAGC	1 cut(s)	224
Bsp19I	CCATGG	1 cut(s)	143
BspANI	GGCC	1 cut(s)	33
BspCNI	CTCAG	1 cut(s)	237
BsrFI	RCCGGY	1 cut(s)	169
BssAI	RCCGGY	1 cut(s)	169
BssECI	CCNNGG	2 cut(s)	60, 143
BssT1I	CCWWGG	2 cut(s)	60, 143
Bst6I	CTCTTC	1 cut(s)	205
BstDEI	CTNAG	1 cut(s)	224
BstDSI	CCRYGG	1 cut(s)	143
BstEII	GGTNACC	1 cut(s)	176
BstF5I	GGATG	2 cut(s)	70, 153
BstPI	GGTNACC	1 cut(s)	176
BsuRI	GGCC	1 cut(s)	33
BtgI	CCRYGG	1 cut(s)	143
BtsCI	GGATG	2 cut(s)	70, 153
Cfr10I	RCCGGY	1 cut(s)	169
Cfr13I	GGNCC	1 cut(s)	32
Csp6I	GTAC	1 cut(s)	167
CspAI	ACCGGT	1 cut(s)	169
CviAII	CATG	1 cut(s)	144
CviJI	RGCY	6 cut(s)	8, 33, 132, 139, 218, 228
CviKI_1	RGCY	6 cut(s)	8, 33, 132, 139, 218, 228
CviQI	GTAC	1 cut(s)	167
DdeI	CTNAG	1 cut(s)	224
DraI	TTTAAA	1 cut(s)	25
Eam1104I	CTCTTC	1 cut(s)	205
EarI	CTCTTC	1 cut(s)	205
Eco130I	CCWWGG	2 cut(s)	60, 143
Eco32I	GATATC	1 cut(s)	193
Eco91I	GGTNACC	1 cut(s)	176
EcoO65I	GGTNACC	1 cut(s)	176
EcoRV	GATATC	1 cut(s)	193
EcoT14I	CCWWGG	2 cut(s)	60, 143
ErhI	CCWWGG	2 cut(s)	60, 143
FaeI	CATG	1 cut(s)	147
FaiI	YATR	6 cut(s)	12, 54, 128, 145, 164, 221
FatI	CATG	1 cut(s)	143
FokI	GGATG	2 cut(s)	77, 160
FspBI	CTAG	2 cut(s)	87, 110
HaeIII	GGCC	1 cut(s)	33
HapII	CCGG	1 cut(s)	170
Hin1II	CATG	1 cut(s)	147
HincII	GTYRAC	1 cut(s)	123
HindII	GTYRAC	1 cut(s)	123
HpaI	GTTAAC	1 cut(s)	123
HpaII	CCGG	1 cut(s)	170
HphI	GGTGA	2 cut(s)	103, 170
Hpy166II	GTNNAC	1 cut(s)	123
Hpy8I	GTNNAC	1 cut(s)	123
HpyAV	CCTTC	1 cut(s)	23
HpyF3I	CTNAG	1 cut(s)	224
Hsp92II	CATG	1 cut(s)	147
KspAI	GTTAAC	1 cut(s)	123
LmnI	GCTCC	1 cut(s)	144
LpnPI	CCDG	3 cut(s)	48, 171, 183
MaeI	CTAG	2 cut(s)	87, 110
MaeIII	GTNAC	1 cut(s)	176
MboII	GAAGA	1 cut(s)	222
MluCI	AATT	3 cut(s)	15, 20, 199
MroXI	GAANNNNTTC	1 cut(s)	75
MseI	TTAA	2 cut(s)	24, 122
MspI	CCGG	1 cut(s)	170
NcoI	CCATGG	1 cut(s)	143
NlaIII	CATG	1 cut(s)	147
NmuCI	GTSAC	1 cut(s)	176
PdmI	GAANNNNTTC	1 cut(s)	75
PinAI	ACCGGT	1 cut(s)	169
PspEI	GGTNACC	1 cut(s)	176
PspPI	GGNCC	1 cut(s)	32
RsaI	GTAC	1 cut(s)	168
RsaNI	GTAC	1 cut(s)	167
SaqAI	TTAA	2 cut(s)	24, 122
Sau96I	GGNCC	1 cut(s)	32
SetI	ASST	4 cut(s)	10, 141, 220, 230
SgeI	CNNG	9 cut(s)	47, 73, 95, 99, 122, 156, 170, 182, 219
Sse9I	AATT	3 cut(s)	15, 20, 199
SspI	AATATT	1 cut(s)	186
SspMI	CTAG	2 cut(s)	87, 110
StyI	CCWWGG	2 cut(s)	60, 143
TasI	AATT	3 cut(s)	15, 20, 199
Tru1I	TTAA	2 cut(s)	24, 122
Tru9I	TTAA	2 cut(s)	24, 122
TseFI	GTSAC	1 cut(s)	176
Tsp45I	GTSAC	1 cut(s)	176
TspDTI	ATGAA	1 cut(s)	220
XapI	RAATTY	1 cut(s)	20
XmnI	GAANNNNTTC	1 cut(s)	75
XspI	CTAG	2 cut(s)	87, 110

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.