Rh7DG405100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
56230592 .. 56234179
3588 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG405100.1

Sequence Viewer

Length: 211 bp
ATGCTCTGTATATGCGCTGATACATGCAAGAGAGCGGAGTTTTGCAGGCGATGGAAGTCTCTCCAAACTAAAAACTCCCTCTCTCAGGTGACAAAATTAGAGCTCATTGGATGTCTACACGATATGCTGTTGCAATACACCGAACCAAGGATGCAGAATGGCTTTGCCATGGTCCACAAAGCCCAACATGAGATTTCAGCAACATTTGATG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.12

Weight (kDa)

8.35

Isoelectric Point (pI)

47.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 35
AccI GTMKAC 1 cut(s) 115
AciI CCGC 1 cut(s) 35
AfiI CCNNNNNNNGG 2 cut(s) 85, 147
AluBI AGCT 1 cut(s) 103
AluI AGCT 1 cut(s) 103
Alw21I GWGCWC 1 cut(s) 105
Alw26I GTCTC 1 cut(s) 63
AspLEI GCGC 1 cut(s) 17
AspS9I GGNCC 1 cut(s) 172
AsuHPI GGTGA 1 cut(s) 100
AvaII GGWCC 1 cut(s) 172
BanII GRGCYC 1 cut(s) 105
Bbv12I GWGCWC 1 cut(s) 105
BccI CCATC 1 cut(s) 45
BcoDI GTCTC 1 cut(s) 63
Bme18I GGWCC 1 cut(s) 172
BmgT120I GGNCC 1 cut(s) 172
BmsI GCATC 1 cut(s) 141
BsaJI CCNNGG 2 cut(s) 146, 168
Bsc4I CCNNNNNNNGG 2 cut(s) 85, 147
BseDI CCNNGG 2 cut(s) 146, 168
BseGI GGATG 2 cut(s) 116, 156
BseLI CCNNNNNNNGG 2 cut(s) 85, 147
BseMII CTCAG 1 cut(s) 98
BsiHKAI GWGCWC 1 cut(s) 105
BslI CCNNNNNNNGG 2 cut(s) 85, 147
BsmAI GTCTC 1 cut(s) 63
Bsp1286I GDGCHC 1 cut(s) 105
Bsp19I CCATGG 1 cut(s) 168
BspACI CCGC 1 cut(s) 35
BspCNI CTCAG 1 cut(s) 97
BsrBI CCGCTC 1 cut(s) 35
BssECI CCNNGG 2 cut(s) 146, 168
BssT1I CCWWGG 2 cut(s) 146, 168
BstC8I GCNNGC 1 cut(s) 47
BstDEI CTNAG 1 cut(s) 84
BstDSI CCRYGG 1 cut(s) 168
BstENI CCTNNNNNAGG 1 cut(s) 83
BstF5I GGATG 2 cut(s) 116, 156
BstHHI GCGC 1 cut(s) 17
BstMAI GTCTC 1 cut(s) 63
BstNSI RCATGY 1 cut(s) 27
BtgI CCRYGG 1 cut(s) 168
BtgZI GCGATG 1 cut(s) 64
BtsCI GGATG 2 cut(s) 116, 156
Cac8I GCNNGC 1 cut(s) 47
CfoI GCGC 1 cut(s) 17
Cfr13I GGNCC 1 cut(s) 172
CviAII CATG 3 cut(s) 24, 169, 188
CviJI RGCY 3 cut(s) 103, 162, 182
CviKI_1 RGCY 3 cut(s) 103, 162, 182
DdeI CTNAG 1 cut(s) 84
Ecl136II GAGCTC 1 cut(s) 103
Eco130I CCWWGG 2 cut(s) 146, 168
Eco24I GRGCYC 1 cut(s) 105
Eco47I GGWCC 1 cut(s) 172
Eco53kI GAGCTC 1 cut(s) 103
EcoICRI GAGCTC 1 cut(s) 103
EcoNI CCTNNNNNAGG 1 cut(s) 83
EcoT14I CCWWGG 2 cut(s) 146, 168
EcoT38I GRGCYC 1 cut(s) 105
ErhI CCWWGG 2 cut(s) 146, 168
FaeI CATG 3 cut(s) 27, 172, 191
FaiI YATR 6 cut(s) 11, 13, 25, 125, 170, 189
FatI CATG 3 cut(s) 23, 168, 187
FblI GTMKAC 1 cut(s) 115
FokI GGATG 2 cut(s) 123, 163
FriOI GRGCYC 1 cut(s) 105
GlaI GCGC 1 cut(s) 16
HhaI GCGC 1 cut(s) 17
Hin1II CATG 3 cut(s) 27, 172, 191
Hin6I GCGC 1 cut(s) 15
HinP1I GCGC 1 cut(s) 15
HphI GGTGA 1 cut(s) 100
Hpy166II GTNNAC 2 cut(s) 116, 175
Hpy8I GTNNAC 2 cut(s) 116, 175
HpyCH4V TGCA 4 cut(s) 27, 45, 133, 154
HpyF3I CTNAG 1 cut(s) 84
Hsp92II CATG 3 cut(s) 27, 172, 191
HspAI GCGC 1 cut(s) 15
LpnPI CCDG 2 cut(s) 31, 71
LweI GCATC 1 cut(s) 141
MaeIII GTNAC 1 cut(s) 88
MbiI CCGCTC 1 cut(s) 35
MhlI GDGCHC 1 cut(s) 105
MluCI AATT 1 cut(s) 95
MnlI CCTC 1 cut(s) 89
NcoI CCATGG 1 cut(s) 168
NlaIII CATG 3 cut(s) 27, 172, 191
NmuCI GTSAC 1 cut(s) 88
NspI RCATGY 1 cut(s) 27
Psp124BI GAGCTC 1 cut(s) 105
PspPI GGNCC 1 cut(s) 172
SacI GAGCTC 1 cut(s) 105
Sau96I GGNCC 1 cut(s) 172
SduI GDGCHC 1 cut(s) 105
SetI ASST 2 cut(s) 90, 105
SfaNI GCATC 1 cut(s) 141
SgeI CNNG 8 cut(s) 36, 40, 58, 98, 131, 159, 181, 200
SinI GGWCC 1 cut(s) 172
Sse9I AATT 1 cut(s) 95
SsiI CCGC 1 cut(s) 35
SstI GAGCTC 1 cut(s) 105
StyI CCWWGG 2 cut(s) 146, 168
TasI AATT 1 cut(s) 95
TseFI GTSAC 1 cut(s) 88
Tsp45I GTSAC 1 cut(s) 88
VpaK11BI GGWCC 1 cut(s) 172
XagI CCTNNNNNAGG 1 cut(s) 83
XceI RCATGY 1 cut(s) 27
XmiI GTMKAC 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.