Rh1BG283100

Argonaute

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Forward (+)
41963349 .. 41965743
2395 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG283100.1

Sequence Viewer

Length: 243 bp
ATGAACCTCTGCAATGTTACTCGTCATGGTCTGGAGACCTCACATCAGTTTCCTGACTCTACCAGCAATATTGAGGTGGTCAGTTCTAGGAAATGGCCTTTGATTTCTCGTTACCGAGCTGCAGTTCGTACTCAATCACCAAAAGTAGAAATGATTGCTAATCTGTTCAAGCCTGTGTCTGATAAAGAGGACCAAGGCATAATCAAGTTGGCTCCTATCTCCCCCTATACTCTGCCACTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

80

Amino Acids

9.02

Weight (kDa)

9.36

Isoelectric Point (pI)

43.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 130
AgsI TTSAA 1 cut(s) 169
AluBI AGCT 1 cut(s) 119
AluI AGCT 1 cut(s) 119
Alw26I GTCTC 1 cut(s) 29
AoxI GGCC 1 cut(s) 95
ApeKI GCWGC 1 cut(s) 119
AspS9I GGNCC 1 cut(s) 190
AsuHPI GGTGA 1 cut(s) 129
AvaII GGWCC 1 cut(s) 190
BbvI GCAGC 1 cut(s) 106
BcoDI GTCTC 1 cut(s) 29
BfaI CTAG 1 cut(s) 87
BfmI CTRYAG 1 cut(s) 120
BisI GCNGC 1 cut(s) 120
BlsI GCNGC 1 cut(s) 121
Bme18I GGWCC 1 cut(s) 190
BmgT120I GGNCC 1 cut(s) 190
BmiI GGNNCC 1 cut(s) 213
BpmI CTGGAG 1 cut(s) 53
BsaI GGTCTC 1 cut(s) 29
BsaJI CCNNGG 1 cut(s) 193
Bse3DI GCAATG 1 cut(s) 19
BseDI CCNNGG 1 cut(s) 193
BseMI GCAATG 1 cut(s) 19
BseXI GCAGC 1 cut(s) 106
BshFI GGCC 1 cut(s) 97
BsmAI GTCTC 1 cut(s) 29
BsnI GGCC 1 cut(s) 97
Bso31I GGTCTC 1 cut(s) 29
BspANI GGCC 1 cut(s) 97
BspLI GGNNCC 1 cut(s) 213
BspMAI CTGCAG 1 cut(s) 124
BspTNI GGTCTC 1 cut(s) 29
BsrDI GCAATG 1 cut(s) 19
BssECI CCNNGG 1 cut(s) 193
BssT1I CCWWGG 1 cut(s) 193
BstMAI GTCTC 1 cut(s) 29
BstSFI CTRYAG 1 cut(s) 120
BstV1I GCAGC 1 cut(s) 106
BsuRI GGCC 1 cut(s) 97
Cfr13I GGNCC 1 cut(s) 190
Csp6I GTAC 1 cut(s) 129
CviAII CATG 1 cut(s) 26
CviJI RGCY 4 cut(s) 97, 119, 172, 212
CviKI_1 RGCY 4 cut(s) 97, 119, 172, 212
CviQI GTAC 1 cut(s) 129
Eco130I CCWWGG 1 cut(s) 193
Eco31I GGTCTC 1 cut(s) 29
Eco47I GGWCC 1 cut(s) 190
EcoT14I CCWWGG 1 cut(s) 193
ErhI CCWWGG 1 cut(s) 193
FaeI CATG 1 cut(s) 29
FaiI YATR 3 cut(s) 27, 200, 228
FatI CATG 1 cut(s) 25
Fnu4HI GCNGC 1 cut(s) 120
Fsp4HI GCNGC 1 cut(s) 120
FspBI CTAG 1 cut(s) 87
GluI GCNGC 1 cut(s) 120
GsuI CTGGAG 1 cut(s) 53
HaeIII GGCC 1 cut(s) 97
Hin1II CATG 1 cut(s) 29
HinfI GANTC 1 cut(s) 56
HphI GGTGA 1 cut(s) 129
Hpy188I TCNGA 1 cut(s) 181
Hpy188III TCNNGA 2 cut(s) 32, 53
HpyCH4V TGCA 2 cut(s) 12, 122
Hsp92II CATG 1 cut(s) 29
LmnI GCTCC 1 cut(s) 217
LpnPI CCDG 4 cut(s) 17, 66, 76, 186
Lsp1109I GCAGC 1 cut(s) 106
MaeI CTAG 1 cut(s) 87
MaeIII GTNAC 2 cut(s) 16, 110
MlyI GAGTC 1 cut(s) 50
MnlI CCTC 4 cut(s) 17, 49, 67, 181
NlaIII CATG 1 cut(s) 29
NlaIV GGNNCC 1 cut(s) 213
PkrI GCNGC 1 cut(s) 121
PleI GAGTC 1 cut(s) 50
PpsI GAGTC 1 cut(s) 50
PspN4I GGNNCC 1 cut(s) 213
PspPI GGNCC 1 cut(s) 190
PstI CTGCAG 1 cut(s) 124
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
SatI GCNGC 1 cut(s) 120
Sau96I GGNCC 1 cut(s) 190
SchI GAGTC 1 cut(s) 50
SetI ASST 4 cut(s) 9, 41, 78, 121
SfcI CTRYAG 1 cut(s) 120
SinI GGWCC 1 cut(s) 190
SspI AATATT 1 cut(s) 70
SspMI CTAG 1 cut(s) 87
StyI CCWWGG 1 cut(s) 193
TseI GCWGC 1 cut(s) 119
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 190
XspI CTAG 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.