Rh6BG246300

Argonaute

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0005181
Physical Location & Seq
Reverse (-)
45778025 .. 45783607
5583 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG246300.1

Sequence Viewer

Length: 333 bp
ATGATCCCAAATCTAGTTGTTGCTTTTGCCGATGAGAACTTCATCGAGGACCTGGAACAATCACCCAACCTCCAGATCGTGACGGAGGCAAGGAACCTCTGCAATGTTACTCGTCATGGTCTGGAGACCTCACATCAGTTTCCTGACTCTACCAGCAATATTGAGGTGGTCAGTTCTAGGAAATGGCCTTTGATTTCTCGTTACCGAGCTGCAGTTCGTACTCAATCACCAAAAGTAGAAATGATTGCTAATCTGTTCAAGCCTGTGTCTGATAAAGAGGACCAAGGCATAATCAAGTTGGCTCCTATCTCCCCCTATACTCTGCCACTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ArgoL1 ArgoL2 ArgoMid ArgoN PAZ Piwi

Protein Analysis

110

Amino Acids

12.39

Weight (kDa)

5.62

Isoelectric Point (pI)

52.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 220
AgsI TTSAA 1 cut(s) 259
AjnI CCWGG 1 cut(s) 51
AluBI AGCT 1 cut(s) 209
AluI AGCT 1 cut(s) 209
Alw26I GTCTC 1 cut(s) 119
AoxI GGCC 1 cut(s) 185
ApeKI GCWGC 1 cut(s) 209
AspS9I GGNCC 2 cut(s) 49, 280
AsuHPI GGTGA 2 cut(s) 54, 219
AvaII GGWCC 2 cut(s) 49, 280
BbvI GCAGC 1 cut(s) 196
BciT130I CCWGG 1 cut(s) 53
BcoDI GTCTC 1 cut(s) 119
BfaI CTAG 2 cut(s) 14, 177
BfmI CTRYAG 1 cut(s) 210
BisI GCNGC 1 cut(s) 210
BlsI GCNGC 1 cut(s) 211
Bme1390I CCNGG 1 cut(s) 53
Bme18I GGWCC 2 cut(s) 49, 280
BmgT120I GGNCC 2 cut(s) 49, 280
BmiI GGNNCC 2 cut(s) 95, 303
BmrFI CCNGG 1 cut(s) 53
BpmI CTGGAG 2 cut(s) 56, 143
BsaI GGTCTC 1 cut(s) 119
BsaJI CCNNGG 1 cut(s) 283
BsaXI ACNNNNNCTCC 2 cut(s) 54, 84
Bse3DI GCAATG 1 cut(s) 109
BseBI CCWGG 1 cut(s) 53
BseDI CCNNGG 1 cut(s) 283
BseMI GCAATG 1 cut(s) 109
BseXI GCAGC 1 cut(s) 196
BshFI GGCC 1 cut(s) 187
BsmAI GTCTC 1 cut(s) 119
BsnI GGCC 1 cut(s) 187
Bso31I GGTCTC 1 cut(s) 119
Bsp143I GATC 2 cut(s) 3, 75
BspANI GGCC 1 cut(s) 187
BspLI GGNNCC 2 cut(s) 95, 303
BspMAI CTGCAG 1 cut(s) 214
BspTNI GGTCTC 1 cut(s) 119
BsrDI GCAATG 1 cut(s) 109
BssECI CCNNGG 1 cut(s) 283
BssMI GATC 2 cut(s) 3, 75
BssT1I CCWWGG 1 cut(s) 283
Bst2UI CCWGG 1 cut(s) 53
BstKTI GATC 2 cut(s) 6, 78
BstMAI GTCTC 1 cut(s) 119
BstMBI GATC 2 cut(s) 3, 75
BstNI CCWGG 1 cut(s) 53
BstSCI CCNGG 1 cut(s) 51
BstSFI CTRYAG 1 cut(s) 210
BstV1I GCAGC 1 cut(s) 196
BsuRI GGCC 1 cut(s) 187
Cfr13I GGNCC 2 cut(s) 49, 280
Csp6I GTAC 1 cut(s) 219
CviAII CATG 1 cut(s) 116
CviJI RGCY 4 cut(s) 187, 209, 262, 302
CviKI_1 RGCY 4 cut(s) 187, 209, 262, 302
CviQI GTAC 1 cut(s) 219
DpnI GATC 2 cut(s) 5, 77
DpnII GATC 2 cut(s) 3, 75
Eco130I CCWWGG 1 cut(s) 283
Eco31I GGTCTC 1 cut(s) 119
Eco47I GGWCC 2 cut(s) 49, 280
EcoO109I RGGNCCY 1 cut(s) 49
EcoRII CCWGG 1 cut(s) 51
EcoT14I CCWWGG 1 cut(s) 283
ErhI CCWWGG 1 cut(s) 283
FaeI CATG 1 cut(s) 119
FaiI YATR 3 cut(s) 117, 290, 318
FatI CATG 1 cut(s) 115
Fnu4HI GCNGC 1 cut(s) 210
Fsp4HI GCNGC 1 cut(s) 210
FspBI CTAG 2 cut(s) 14, 177
GluI GCNGC 1 cut(s) 210
GsuI CTGGAG 2 cut(s) 56, 143
HaeIII GGCC 1 cut(s) 187
Hin1II CATG 1 cut(s) 119
HinfI GANTC 1 cut(s) 146
HphI GGTGA 2 cut(s) 54, 219
Hpy188I TCNGA 1 cut(s) 271
Hpy188III TCNNGA 4 cut(s) 73, 79, 122, 143
HpyCH4V TGCA 2 cut(s) 102, 212
Hsp92II CATG 1 cut(s) 119
Kzo9I GATC 2 cut(s) 3, 75
LmnI GCTCC 1 cut(s) 307
LpnPI CCDG 7 cut(s) 38, 65, 86, 107, 156, 166, 276
Lsp1109I GCAGC 1 cut(s) 196
MaeI CTAG 2 cut(s) 14, 177
MaeIII GTNAC 3 cut(s) 79, 106, 200
MalI GATC 2 cut(s) 5, 77
MboI GATC 2 cut(s) 3, 75
MlyI GAGTC 1 cut(s) 140
MnlI CCTC 7 cut(s) 40, 79, 80, 107, 139, 157, 271
MspR9I CCNGG 1 cut(s) 53
MvaI CCWGG 1 cut(s) 53
NdeII GATC 2 cut(s) 3, 75
NlaIII CATG 1 cut(s) 119
NlaIV GGNNCC 2 cut(s) 95, 303
NmuCI GTSAC 1 cut(s) 79
PkrI GCNGC 1 cut(s) 211
PleI GAGTC 1 cut(s) 140
PpsI GAGTC 1 cut(s) 140
PpuMI RGGWCCY 1 cut(s) 49
Psp5II RGGWCCY 1 cut(s) 49
Psp6I CCWGG 1 cut(s) 51
PspGI CCWGG 1 cut(s) 51
PspN4I GGNNCC 2 cut(s) 95, 303
PspPI GGNCC 2 cut(s) 49, 280
PspPPI RGGWCCY 1 cut(s) 49
PstI CTGCAG 1 cut(s) 214
RsaI GTAC 1 cut(s) 220
RsaNI GTAC 1 cut(s) 219
SatI GCNGC 1 cut(s) 210
Sau3AI GATC 2 cut(s) 3, 75
Sau96I GGNCC 2 cut(s) 49, 280
SchI GAGTC 1 cut(s) 140
ScrFI CCNGG 1 cut(s) 53
SetI ASST 6 cut(s) 54, 72, 99, 131, 168, 211
SfcI CTRYAG 1 cut(s) 210
SinI GGWCC 2 cut(s) 49, 280
SspI AATATT 1 cut(s) 160
SspMI CTAG 2 cut(s) 14, 177
StyD4I CCNGG 1 cut(s) 51
StyI CCWWGG 1 cut(s) 283
TaqI TCGA 1 cut(s) 45
TseFI GTSAC 1 cut(s) 79
TseI GCWGC 1 cut(s) 209
Tsp45I GTSAC 1 cut(s) 79
TspDTI ATGAA 1 cut(s) 31
TspGWI ACGGA 1 cut(s) 98
VpaK11BI GGWCC 2 cut(s) 49, 280
XspI CTAG 2 cut(s) 14, 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.