Rmu_sc0001444.1_g000005

Belongs to the mitochondrial carrier (TC 2.A.29) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001444.1
Physical Location & Seq
Reverse (-)
18252 .. 18554
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001444.1_g000005.1.cds

Sequence Viewer

Length: 303 bp
atggaagagaagcagagagtagccactggaattgcaaatgaccatctgagcaagaagaagaagaccaagccagggtacgacgtgccgtttattgagcgttggccgtcgctaaagccctttgtgaatggcggactcgctgcgtttcttcaaggcttgaccctttatgttcctttcgctgccatctactactccccattgttatctcccattcgccgaagtcccagatttctgggcttcaacattcttgccaaggtcccatctttttcactttcagggttttgggttttgggttttgagttttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.28

Weight (kDa)

9.99

Isoelectric Point (pI)

69.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 129
AcoI YGGCCR 1 cut(s) 101
AfaI GTAC 1 cut(s) 77
AfiI CCNNNNNNNGG 1 cut(s) 72
AgsI TTSAA 2 cut(s) 149, 238
AjiI CACGTC 1 cut(s) 82
AjnI CCWGG 1 cut(s) 70
AoxI GGCC 1 cut(s) 101
ApeKI GCWGC 2 cut(s) 137, 176
AspS9I GGNCC 1 cut(s) 253
AvaII GGWCC 1 cut(s) 253
BbsI GAAGAC 1 cut(s) 68
BbvI GCAGC 2 cut(s) 124, 163
BccI CCATC 3 cut(s) 51, 188, 265
BceAI ACGGC 2 cut(s) 70, 88
BciT130I CCWGG 1 cut(s) 72
BisI GCNGC 2 cut(s) 138, 177
BlsI GCNGC 2 cut(s) 139, 178
Bme1390I CCNGG 1 cut(s) 72
Bme18I GGWCC 1 cut(s) 253
BmgBI CACGTC 1 cut(s) 82
BmgT120I GGNCC 1 cut(s) 253
BmiI GGNNCC 1 cut(s) 255
BmrFI CCNGG 1 cut(s) 72
BpiI GAAGAC 1 cut(s) 68
BsaJI CCNNGG 2 cut(s) 71, 249
Bsc4I CCNNNNNNNGG 1 cut(s) 72
Bse1I ACTGG 1 cut(s) 31
BseBI CCWGG 1 cut(s) 72
BseDI CCNNGG 2 cut(s) 71, 249
BseLI CCNNNNNNNGG 1 cut(s) 72
BseMII CTCAG 1 cut(s) 38
BseNI ACTGG 1 cut(s) 31
BseXI GCAGC 2 cut(s) 124, 163
BshFI GGCC 1 cut(s) 103
BslFI GGGAC 2 cut(s) 204, 239
BslI CCNNNNNNNGG 1 cut(s) 72
BsmFI GGGAC 2 cut(s) 204, 239
BsnI GGCC 1 cut(s) 103
BspACI CCGC 1 cut(s) 129
BspANI GGCC 1 cut(s) 103
BspCNI CTCAG 1 cut(s) 39
BspLI GGNNCC 1 cut(s) 255
BsrI ACTGG 1 cut(s) 31
BssECI CCNNGG 2 cut(s) 71, 249
BssT1I CCWWGG 1 cut(s) 249
Bst2UI CCWGG 1 cut(s) 72
BstDEI CTNAG 1 cut(s) 47
BstNI CCWGG 1 cut(s) 72
BstSCI CCNGG 1 cut(s) 70
BstV1I GCAGC 2 cut(s) 124, 163
BstV2I GAAGAC 1 cut(s) 68
BstXI CCANNNNNNTGG 1 cut(s) 229
BsuRI GGCC 1 cut(s) 103
BtrI CACGTC 1 cut(s) 82
BtsIMutI CAGTG 1 cut(s) 24
Cfr13I GGNCC 1 cut(s) 253
Csp6I GTAC 1 cut(s) 76
CspCI CAANNNNNGTGG 2 cut(s) 13, 48
CviJI RGCY 6 cut(s) 23, 70, 103, 115, 153, 234
CviKI_1 RGCY 6 cut(s) 23, 70, 103, 115, 153, 234
CviQI GTAC 1 cut(s) 76
DdeI CTNAG 1 cut(s) 47
EaeI YGGCCR 1 cut(s) 101
EciI GGCGGA 1 cut(s) 144
Eco130I CCWWGG 1 cut(s) 249
Eco47I GGWCC 1 cut(s) 253
EcoO109I RGGNCCY 1 cut(s) 253
EcoRII CCWGG 1 cut(s) 70
EcoT14I CCWWGG 1 cut(s) 249
ErhI CCWWGG 1 cut(s) 249
FaiI YATR 1 cut(s) 165
FaqI GGGAC 2 cut(s) 204, 239
Fnu4HI GCNGC 2 cut(s) 138, 177
Fsp4HI GCNGC 2 cut(s) 138, 177
GluI GCNGC 2 cut(s) 138, 177
HaeIII GGCC 1 cut(s) 103
HinfI GANTC 1 cut(s) 132
Hpy188I TCNGA 1 cut(s) 48
Hpy99I CGWCG 2 cut(s) 83, 109
HpyCH4IV ACGT 1 cut(s) 81
HpyCH4V TGCA 1 cut(s) 35
HpyF3I CTNAG 1 cut(s) 47
HpySE526I ACGT 1 cut(s) 81
LpnPI CCDG 6 cut(s) 12, 57, 84, 215, 235, 258
Lsp1109I GCAGC 2 cut(s) 124, 163
MaeII ACGT 1 cut(s) 81
MboII GAAGA 5 cut(s) 17, 67, 70, 73, 137
MluCI AATT 1 cut(s) 30
MlyI GAGTC 1 cut(s) 126
MspR9I CCNGG 1 cut(s) 72
MvaI CCWGG 1 cut(s) 72
NlaIV GGNNCC 1 cut(s) 255
PkrI GCNGC 2 cut(s) 139, 178
PleI GAGTC 1 cut(s) 126
PpsI GAGTC 1 cut(s) 126
PpuMI RGGWCCY 1 cut(s) 253
Psp5II RGGWCCY 1 cut(s) 253
Psp6I CCWGG 1 cut(s) 70
PspGI CCWGG 1 cut(s) 70
PspN4I GGNNCC 1 cut(s) 255
PspPI GGNCC 1 cut(s) 253
PspPPI RGGWCCY 1 cut(s) 253
RsaI GTAC 1 cut(s) 77
RsaNI GTAC 1 cut(s) 76
SatI GCNGC 2 cut(s) 138, 177
Sau96I GGNCC 1 cut(s) 253
SchI GAGTC 1 cut(s) 126
ScrFI CCNGG 1 cut(s) 72
SetI ASST 2 cut(s) 84, 255
SinI GGWCC 1 cut(s) 253
Sse9I AATT 1 cut(s) 30
SsiI CCGC 1 cut(s) 129
StyD4I CCNGG 1 cut(s) 70
StyI CCWWGG 1 cut(s) 249
TaiI ACGT 1 cut(s) 84
TasI AATT 1 cut(s) 30
TscAI CASTG 1 cut(s) 31
TseI GCWGC 2 cut(s) 137, 176
TspRI CASTG 1 cut(s) 31
VpaK11BI GGWCC 1 cut(s) 253
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.