Rw5G050550

Belongs to the mitochondrial carrier (TC 2.A.29) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
OG0004537
Physical Location & Seq
Reverse (-)
87308927 .. 87310099
1173 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G050550.1

Sequence Viewer

Length: 357 bp
ATGAGTGCCAATAAAAAAATTTCAGCACTATGGACAAATGCTGGTCCTTATGTTAAGACAAGAATGGGGACTAATGTGGGTATGCTCGCATCATATAATCCAAGCCTCTGTTATCTCAGGGATTCATGTGGTTTAAGCGAAGCAAGAGCACAGCTGGGTGCAAGTGTGGTTTCAGCGTACTTCGGTGCAGCATGCTCTGTACCATTAAAAAATGTTCTAGCACAAGGGGAAAGTGGCTCCTCCCTGGATTGTGCCCTTAAAATTCTAAAATCAAGAGGACCCCTTGCATTCTTTTCAGGATTTTCTAGACAGTTTGCACTTGTTGGACCTCCTATCATGGTCCTCCCTCCCTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Mito_carr

Protein Analysis

118

Amino Acids

12.34

Weight (kDa)

9.59

Isoelectric Point (pI)

35.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 18, 261
AfaI GTAC 2 cut(s) 179, 201
AjnI CCWGG 1 cut(s) 243
AluBI AGCT 1 cut(s) 154
AluI AGCT 1 cut(s) 154
Alw21I GWGCWC 1 cut(s) 151
ApeKI GCWGC 1 cut(s) 188
ApoI RAATTY 2 cut(s) 18, 261
AspS9I GGNCC 4 cut(s) 44, 278, 326, 340
AvaII GGWCC 4 cut(s) 44, 278, 326, 340
BaeGI GKGCMC 1 cut(s) 256
Bbv12I GWGCWC 1 cut(s) 151
BbvI GCAGC 1 cut(s) 200
BciT130I CCWGG 1 cut(s) 245
BfaI CTAG 2 cut(s) 218, 306
BisI GCNGC 1 cut(s) 189
BlsI GCNGC 1 cut(s) 190
Bme1390I CCNGG 1 cut(s) 245
Bme18I GGWCC 4 cut(s) 44, 278, 326, 340
BmgT120I GGNCC 4 cut(s) 44, 278, 326, 340
BmiI GGNNCC 2 cut(s) 238, 280
BmrFI CCNGG 1 cut(s) 245
BmsI GCATC 1 cut(s) 98
BsaJI CCNNGG 1 cut(s) 243
BseBI CCWGG 1 cut(s) 245
BseDI CCNNGG 1 cut(s) 243
BseMII CTCAG 1 cut(s) 130
BseRI GAGGAG 1 cut(s) 229
BseSI GKGCMC 1 cut(s) 256
BseXI GCAGC 1 cut(s) 200
BseYI CCCAGC 1 cut(s) 154
BsgI GTGCAG 1 cut(s) 207
BsiHKAI GWGCWC 1 cut(s) 151
BslFI GGGAC 1 cut(s) 82
BsmFI GGGAC 1 cut(s) 82
BsmI GAATGC 1 cut(s) 287
Bsp1286I GDGCHC 2 cut(s) 151, 256
BspCNI CTCAG 1 cut(s) 129
BspLI GGNNCC 2 cut(s) 238, 280
BssECI CCNNGG 1 cut(s) 243
Bst2UI CCWGG 1 cut(s) 245
Bst4CI ACNGT 1 cut(s) 312
BstC8I GCNNGC 2 cut(s) 87, 193
BstDEI CTNAG 1 cut(s) 116
BstNI CCWGG 1 cut(s) 245
BstNSI RCATGY 1 cut(s) 195
BstSCI CCNGG 1 cut(s) 243
BstSLI GKGCMC 1 cut(s) 256
BstV1I GCAGC 1 cut(s) 200
Cac8I GCNNGC 2 cut(s) 87, 193
Cfr13I GGNCC 4 cut(s) 44, 278, 326, 340
Csp6I GTAC 2 cut(s) 178, 200
CviAII CATG 3 cut(s) 126, 192, 337
CviJI RGCY 3 cut(s) 105, 154, 237
CviKI_1 RGCY 3 cut(s) 105, 154, 237
CviQI GTAC 2 cut(s) 178, 200
DdeI CTNAG 1 cut(s) 116
Eco47I GGWCC 4 cut(s) 44, 278, 326, 340
EcoO109I RGGNCCY 1 cut(s) 278
EcoRII CCWGG 1 cut(s) 243
FaeI CATG 3 cut(s) 129, 195, 340
FaiI YATR 9 cut(s) 31, 51, 83, 94, 96, 127, 193, 338, 355
FaqI GGGAC 1 cut(s) 82
FatI CATG 3 cut(s) 125, 191, 336
Fnu4HI GCNGC 1 cut(s) 189
Fsp4HI GCNGC 1 cut(s) 189
FspBI CTAG 2 cut(s) 218, 306
GluI GCNGC 1 cut(s) 189
GsaI CCCAGC 1 cut(s) 158
Hin1II CATG 3 cut(s) 129, 195, 340
HinfI GANTC 1 cut(s) 122
Hpy188III TCNNGA 3 cut(s) 273, 297, 306
HpyCH4III ACNGT 1 cut(s) 312
HpyCH4V TGCA 4 cut(s) 161, 188, 287, 317
HpyF3I CTNAG 1 cut(s) 116
Hsp92II CATG 3 cut(s) 129, 195, 340
LmnI GCTCC 1 cut(s) 242
LpnPI CCDG 6 cut(s) 27, 103, 140, 230, 257, 282
Lsp1109I GCAGC 1 cut(s) 200
LweI GCATC 1 cut(s) 98
MaeI CTAG 2 cut(s) 218, 306
MhlI GDGCHC 2 cut(s) 151, 256
MluCI AATT 2 cut(s) 18, 261
MmeI TCCRAC 1 cut(s) 304
MnlI CCTC 6 cut(s) 116, 250, 269, 339, 353, 357
MseI TTAA 4 cut(s) 54, 134, 206, 258
MspA1I CMGCKG 1 cut(s) 154
MspR9I CCNGG 1 cut(s) 245
Mva1269I GAATGC 1 cut(s) 287
MvaI CCWGG 1 cut(s) 245
NlaIII CATG 3 cut(s) 129, 195, 340
NlaIV GGNNCC 2 cut(s) 238, 280
NspI RCATGY 1 cut(s) 195
PaeI GCATGC 1 cut(s) 195
PctI GAATGC 1 cut(s) 287
PfeI GAWTC 1 cut(s) 122
PkrI GCNGC 1 cut(s) 190
PpuMI RGGWCCY 1 cut(s) 278
Psp5II RGGWCCY 1 cut(s) 278
Psp6I CCWGG 1 cut(s) 243
PspFI CCCAGC 1 cut(s) 154
PspGI CCWGG 1 cut(s) 243
PspN4I GGNNCC 2 cut(s) 238, 280
PspPI GGNCC 4 cut(s) 44, 278, 326, 340
PspPPI RGGWCCY 1 cut(s) 278
PvuII CAGCTG 1 cut(s) 154
RsaI GTAC 2 cut(s) 179, 201
RsaNI GTAC 2 cut(s) 178, 200
SaqAI TTAA 4 cut(s) 54, 134, 206, 258
SatI GCNGC 1 cut(s) 189
Sau96I GGNCC 4 cut(s) 44, 278, 326, 340
ScrFI CCNGG 1 cut(s) 245
SduI GDGCHC 2 cut(s) 151, 256
SetI ASST 2 cut(s) 156, 331
SfaNI GCATC 1 cut(s) 98
SinI GGWCC 4 cut(s) 44, 278, 326, 340
SphI GCATGC 1 cut(s) 195
Sse9I AATT 2 cut(s) 18, 261
SspMI CTAG 2 cut(s) 218, 306
StyD4I CCNGG 1 cut(s) 243
TaaI ACNGT 1 cut(s) 312
TasI AATT 2 cut(s) 18, 261
TfiI GAWTC 1 cut(s) 122
Tru1I TTAA 4 cut(s) 54, 134, 206, 258
Tru9I TTAA 4 cut(s) 54, 134, 206, 258
TseI GCWGC 1 cut(s) 188
TspDTI ATGAA 1 cut(s) 114
VpaK11BI GGWCC 4 cut(s) 44, 278, 326, 340
XapI RAATTY 2 cut(s) 18, 261
XbaI TCTAGA 1 cut(s) 305
XceI RCATGY 1 cut(s) 195
XspI CTAG 2 cut(s) 218, 306
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.