Rmu_sc0001465.1_g000007

Ferric reduction oxidase 4-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001465.1
Physical Location & Seq
Forward (+)
21021 .. 22192
1172 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001465.1_g000007.1.cds

Sequence Viewer

Length: 783 bp
atgattagtggaggcagtggaattacaccgatgatctccataatccgagaaatcattttccaaagcaccaaaccagactgccatgttccgcctgttcggttgatatgtgccttcaagaactcagctgatctcaccatgctacaactcttgcttccaatttctgtcacaccttctaattttacccagctgcagtttcaaattgaagcatatgtgaccagggagacacacaagcagcctccaccagaaccccacaagtctctccaaaccttatggtttaagccaaaccaactgaactcacccatttctttggttctaggacaaaacacttggctatggcttggtgctataatctcatcctcatttgtcttatttctctttgttttgggcattgtcaatcgtttctatatatacccaatcgaccacaacactggtgaacactaccatgtctccttcatttgcctgtgtgcagtctacatttggtgcaagagacagaacgccatcgaagatgcgaagcaaactcagaatgcgaaattatcaacaccaacaactgatatcgaacttgcgagttctccccataatcatgagtccctgatcgctcaagctacccaagtgcattatggaactaggcctgacctgaagaaaattctgttattggaaaccaaaggatctgatattggagtgttggttagtggcccaaggaagttgagacatgaggttgccacagtctgttcatccagtttggcacataatctgcactttgagtccattagctttaactggtga
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

260

Amino Acids

29.21

Weight (kDa)

8.21

Isoelectric Point (pI)

46.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 471
AciI CCGC 1 cut(s) 89
AclWI GGATC 1 cut(s) 673
AcsI RAATTY 1 cut(s) 642
AcuI CTGAAG 1 cut(s) 656
AgsI TTSAA 3 cut(s) 115, 197, 203
AjnI CCWGG 1 cut(s) 215
AluBI AGCT 4 cut(s) 125, 187, 602, 771
AluI AGCT 4 cut(s) 125, 187, 602, 771
Alw26I GTCTC 5 cut(s) 215, 261, 451, 481, 700
AlwI GGATC 1 cut(s) 673
AoxI GGCC 2 cut(s) 626, 691
ApeKI GCWGC 2 cut(s) 187, 232
ApoI RAATTY 1 cut(s) 642
AspS9I GGNCC 1 cut(s) 692
AsuHPI GGTGA 3 cut(s) 124, 288, 443
BbvI GCAGC 2 cut(s) 174, 244
BccI CCATC 1 cut(s) 506
BciT130I CCWGG 1 cut(s) 217
BcoDI GTCTC 5 cut(s) 215, 261, 451, 481, 700
BfaI CTAG 2 cut(s) 314, 624
BfmI CTRYAG 1 cut(s) 188
BisI GCNGC 2 cut(s) 188, 233
BlsI GCNGC 2 cut(s) 189, 234
Bme1390I CCNGG 1 cut(s) 217
BmgT120I GGNCC 1 cut(s) 692
BmrFI CCNGG 1 cut(s) 217
BmsI GCATC 1 cut(s) 496
BpuEI CTTGAG 1 cut(s) 582
BsaJI CCNNGG 2 cut(s) 216, 695
BsaXI ACNNNNNCTCC 4 cut(s) 431, 461, 669, 699
Bse1I ACTGG 3 cut(s) 433, 735, 782
BseBI CCWGG 1 cut(s) 217
BseDI CCNNGG 2 cut(s) 216, 695
BseGI GGATG 2 cut(s) 353, 731
BseMII CTCAG 2 cut(s) 135, 533
BseNI ACTGG 3 cut(s) 433, 735, 782
BseXI GCAGC 2 cut(s) 174, 244
BseYI CCCAGC 1 cut(s) 183
BsgI GTGCAG 2 cut(s) 486, 737
BshFI GGCC 2 cut(s) 628, 693
BslFI GGGAC 1 cut(s) 571
BsmAI GTCTC 5 cut(s) 215, 261, 451, 481, 700
BsmFI GGGAC 1 cut(s) 571
BsmI GAATGC 1 cut(s) 529
BsnI GGCC 2 cut(s) 628, 693
Bsp143I GATC 4 cut(s) 33, 127, 591, 665
BspACI CCGC 1 cut(s) 89
BspANI GGCC 2 cut(s) 628, 693
BspCNI CTCAG 2 cut(s) 134, 532
BspHI TCATGA 1 cut(s) 580
BspMAI CTGCAG 1 cut(s) 192
BspPI GGATC 1 cut(s) 673
BsrI ACTGG 3 cut(s) 433, 735, 782
BssECI CCNNGG 2 cut(s) 216, 695
BssMI GATC 4 cut(s) 33, 127, 591, 665
BssT1I CCWWGG 1 cut(s) 695
Bst2UI CCWGG 1 cut(s) 217
Bst4CI ACNGT 1 cut(s) 724
BstDEI CTNAG 2 cut(s) 121, 519
BstF5I GGATG 2 cut(s) 353, 731
BstKTI GATC 4 cut(s) 36, 130, 594, 668
BstMAI GTCTC 5 cut(s) 215, 261, 451, 481, 700
BstMBI GATC 4 cut(s) 33, 127, 591, 665
BstNI CCWGG 1 cut(s) 217
BstSCI CCNGG 1 cut(s) 215
BstSFI CTRYAG 1 cut(s) 188
BstV1I GCAGC 2 cut(s) 174, 244
BstX2I RGATCY 1 cut(s) 665
BstXI CCANNNNNNTGG 2 cut(s) 307, 428
BstYI RGATCY 1 cut(s) 665
BsuRI GGCC 2 cut(s) 628, 693
BtsCI GGATG 2 cut(s) 353, 731
BtsI GCAGTG 1 cut(s) 22
BtsIMutI CAGTG 2 cut(s) 22, 426
CciI TCATGA 1 cut(s) 580
Cfr13I GGNCC 1 cut(s) 692
CviAII CATG 5 cut(s) 83, 136, 443, 581, 710
DdeI CTNAG 2 cut(s) 121, 519
DpnI GATC 4 cut(s) 35, 129, 593, 667
DpnII GATC 4 cut(s) 33, 127, 591, 665
EciI GGCGGA 1 cut(s) 78
Eco130I CCWWGG 1 cut(s) 695
Eco147I AGGCCT 1 cut(s) 628
Eco32I GATATC 1 cut(s) 553
Eco57I CTGAAG 1 cut(s) 656
EcoRII CCWGG 1 cut(s) 215
EcoRV GATATC 1 cut(s) 553
EcoT14I CCWWGG 1 cut(s) 695
ErhI CCWWGG 1 cut(s) 695
FaeI CATG 5 cut(s) 86, 139, 446, 584, 713
FaqI GGGAC 1 cut(s) 571
FatI CATG 5 cut(s) 82, 135, 442, 580, 709
FauNDI CATATG 1 cut(s) 208
FblI GTMKAC 1 cut(s) 471
Fnu4HI GCNGC 2 cut(s) 188, 233
FokI GGATG 2 cut(s) 340, 718
Fsp4HI GCNGC 2 cut(s) 188, 233
FspBI CTAG 2 cut(s) 314, 624
GluI GCNGC 2 cut(s) 188, 233
GsaI CCCAGC 1 cut(s) 187
HaeIII GGCC 2 cut(s) 628, 693
Hin1II CATG 5 cut(s) 86, 139, 446, 584, 713
HinfI GANTC 2 cut(s) 584, 761
HphI GGTGA 3 cut(s) 124, 288, 443
Hpy166II GTNNAC 2 cut(s) 434, 472
Hpy188I TCNGA 3 cut(s) 47, 522, 670
Hpy188III TCNNGA 2 cut(s) 115, 581
Hpy8I GTNNAC 2 cut(s) 434, 472
HpyAV CCTTC 3 cut(s) 121, 180, 460
HpyCH4III ACNGT 1 cut(s) 724
HpyCH4V TGCA 5 cut(s) 190, 467, 483, 613, 754
HpyF3I CTNAG 2 cut(s) 121, 519
Hsp92II CATG 5 cut(s) 86, 139, 446, 584, 713
Kzo9I GATC 4 cut(s) 33, 127, 591, 665
Lsp1109I GCAGC 2 cut(s) 174, 244
LweI GCATC 1 cut(s) 496
MaeI CTAG 2 cut(s) 314, 624
MaeIII GTNAC 2 cut(s) 163, 211
MalI GATC 4 cut(s) 35, 129, 593, 667
MboI GATC 4 cut(s) 33, 127, 591, 665
MboII GAAGA 2 cut(s) 515, 649
MflI RGATCY 1 cut(s) 665
MluCI AATT 6 cut(s) 21, 156, 175, 198, 530, 642
MlyI GAGTC 2 cut(s) 593, 770
MnlI CCTC 4 cut(s) 5, 246, 367, 706
MseI TTAA 2 cut(s) 276, 774
MslI CAYNNNNRTG 2 cut(s) 441, 579
MspA1I CMGCKG 2 cut(s) 125, 187
MspR9I CCNGG 1 cut(s) 217
Mva1269I GAATGC 1 cut(s) 529
MvaI CCWGG 1 cut(s) 217
NdeI CATATG 1 cut(s) 208
NdeII GATC 4 cut(s) 33, 127, 591, 665
NlaIII CATG 5 cut(s) 86, 139, 446, 584, 713
NmuCI GTSAC 2 cut(s) 163, 211
PagI TCATGA 1 cut(s) 580
PceI AGGCCT 1 cut(s) 628
PctI GAATGC 1 cut(s) 529
PkrI GCNGC 2 cut(s) 189, 234
PleI GAGTC 2 cut(s) 592, 769
PpsI GAGTC 2 cut(s) 592, 769
Psp6I CCWGG 1 cut(s) 215
PspFI CCCAGC 1 cut(s) 183
PspGI CCWGG 1 cut(s) 215
PspPI GGNCC 1 cut(s) 692
PstI CTGCAG 1 cut(s) 192
PsuI RGATCY 1 cut(s) 665
PvuII CAGCTG 2 cut(s) 125, 187
RseI CAYNNNNRTG 2 cut(s) 441, 579
SaqAI TTAA 2 cut(s) 276, 774
SatI GCNGC 2 cut(s) 188, 233
Sau3AI GATC 4 cut(s) 33, 127, 591, 665
Sau96I GGNCC 1 cut(s) 692
SchI GAGTC 2 cut(s) 593, 770
ScrFI CCNGG 1 cut(s) 217
SetI ASST 8 cut(s) 127, 172, 189, 269, 604, 636, 717, 773
SfaNI GCATC 1 cut(s) 496
SfcI CTRYAG 1 cut(s) 188
SmiMI CAYNNNNRTG 2 cut(s) 441, 579
SmlI CTYRAG 1 cut(s) 597
SmoI CTYRAG 1 cut(s) 597
Sse9I AATT 6 cut(s) 21, 156, 175, 198, 530, 642
SseBI AGGCCT 1 cut(s) 628
SsiI CCGC 1 cut(s) 89
SspMI CTAG 2 cut(s) 314, 624
StuI AGGCCT 1 cut(s) 628
StyD4I CCNGG 1 cut(s) 215
StyI CCWWGG 1 cut(s) 695
TaaI ACNGT 1 cut(s) 724
TaqI TCGA 3 cut(s) 417, 501, 555
TasI AATT 6 cut(s) 21, 156, 175, 198, 530, 642
Tru1I TTAA 2 cut(s) 276, 774
Tru9I TTAA 2 cut(s) 276, 774
TscAI CASTG 2 cut(s) 22, 433
TseFI GTSAC 2 cut(s) 163, 211
TseI GCWGC 2 cut(s) 187, 232
Tsp45I GTSAC 2 cut(s) 163, 211
TspDTI ATGAA 2 cut(s) 442, 720
TspRI CASTG 2 cut(s) 22, 433
XapI RAATTY 1 cut(s) 642
XcmI CCANNNNNNNNNTGG 1 cut(s) 614
XmiI GTMKAC 1 cut(s) 471
XspI CTAG 2 cut(s) 314, 624
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.