Rmu_sc0001654.1_g000029

hydroxyproline O-arabinosyltransferase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001654.1
Physical Location & Seq
Forward (+)
102626 .. 105087
2462 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001654.1_g000029.1.cds

Sequence Viewer

Length: 978 bp
atgattgggaggaagaacatggggcgtgcttcaccattacttctgtttctcttggcttttgggtttttctttgccacttacaatcttttgacgatgatactccactatagatctgttgggaagtgggtaggtggtaatagtaacagtcgtttgctggctgatcccattgtcgagatgcctgagaatgtgaaagtcaaaggttccaaagcaccattccatgttgccttaacagcaacggatgctccttatagtaaatggcagtgtcgcattatgtattattggtataagaagaagaaggacatgcctggatcagaaatgggaggatttactcgaattttgcattcgggaagacctgacaacttgatggatgagattcccactatggtggttgatcctctgcctgccggtcttgatcggggatatattgtcttaaataggccatgggcttttgtgcaatggctggaaaaggctacaattgaggaagaatatgtgttgatggcagagcctgatcatatatttataaatcctcttcctaatttggcccatggaggatatcctgctgccttcccctttttctacattaaacctacacagaatgagaagatcataagaaagttttaccccaaagagaatggcccagtcacaaatattgatccaattggaaattctccagtaattatcaagaaggatatgctggaaaagattgctccgacatggatgaatatttctttgagcatgaaagaagacacagagactgataaagcttttggatgggtgctagaaatgtatgcttatgctgtagcatctgctttgcacggtgtgcagcatgttcttcggaaggacttcatgctgcagcccccttgggatttggaaattggtaaaaagtttattattcactacacttatgggtgtgactacaacttaaaggtatgcattatcgtttcccctatttggctattttctgttatggttttgtga

Protein Analysis

325

Amino Acids

37.21

Weight (kDa)

8.72

Isoelectric Point (pI)

41.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 521
AclWI GGATC 4 cut(s) 155, 316, 386, 647
AcsI RAATTY 2 cut(s) 333, 664
AdeI CACNNNGTG 1 cut(s) 820
AfiI CCNNNNNNNGG 1 cut(s) 951
AjnI CCWGG 1 cut(s) 304
AjuI GAANNNNNNNTTGG 4 cut(s) 197, 229, 649, 681
AleI CACNNNNGTG 1 cut(s) 383
AluBI AGCT 1 cut(s) 764
AluI AGCT 1 cut(s) 764
Alw26I GTCTC 1 cut(s) 746
AlwI GGATC 4 cut(s) 155, 316, 386, 647
AlwNI CAGNNNCTG 2 cut(s) 506, 755
AoxI GGCC 3 cut(s) 437, 540, 634
ApeKI GCWGC 4 cut(s) 560, 823, 850, 853
ApoI RAATTY 2 cut(s) 333, 664
Asp700I GAANNNNTTC 1 cut(s) 842
AspS9I GGNCC 2 cut(s) 541, 635
AsuHPI GGTGA 1 cut(s) 24
BbsI GAAGAC 2 cut(s) 355, 750
BbvI GCAGC 4 cut(s) 547, 835, 837, 865
BccI CCATC 3 cut(s) 358, 490, 765
BcgI CGANNNNNNTGC 2 cut(s) 815, 849
BciT130I CCWGG 1 cut(s) 306
BclI TGATCA 1 cut(s) 508
BcoDI GTCTC 1 cut(s) 746
BfaI CTAG 1 cut(s) 779
BfmI CTRYAG 3 cut(s) 106, 798, 851
BglII AGATCT 1 cut(s) 110
BisI GCNGC 4 cut(s) 561, 824, 851, 854
BlsI GCNGC 4 cut(s) 562, 825, 852, 855
Bme1390I CCNGG 1 cut(s) 306
BmgT120I GGNCC 2 cut(s) 541, 635
BmiI GGNNCC 1 cut(s) 202
BmrFI CCNGG 1 cut(s) 306
BmrI ACTGGG 1 cut(s) 632
BmsI GCATC 3 cut(s) 165, 229, 812
BmuI ACTGGG 1 cut(s) 632
BpiI GAAGAC 2 cut(s) 355, 750
BpmI CTGGAG 1 cut(s) 654
BsaJI CCNNGG 3 cut(s) 440, 544, 860
BsaXI ACNNNNNCTCC 2 cut(s) 226, 256
Bsc4I CCNNNNNNNGG 1 cut(s) 951
Bse118I RCCGGY 1 cut(s) 404
Bse1I ACTGG 2 cut(s) 638, 671
Bse3DI GCAATG 1 cut(s) 461
BseBI CCWGG 1 cut(s) 306
BseDI CCNNGG 3 cut(s) 440, 544, 860
BseGI GGATG 4 cut(s) 244, 373, 723, 776
BseLI CCNNNNNNNGG 1 cut(s) 951
BseMI GCAATG 1 cut(s) 461
BseMII CTCAG 1 cut(s) 171
BseNI ACTGG 2 cut(s) 638, 671
BseXI GCAGC 4 cut(s) 547, 835, 837, 865
BsgI GTGCAG 1 cut(s) 842
BshFI GGCC 3 cut(s) 439, 542, 636
BsiSI CCGG 1 cut(s) 405
BslI CCNNNNNNNGG 1 cut(s) 951
BsmAI GTCTC 1 cut(s) 746
BsmI GAATGC 1 cut(s) 340
BsnI GGCC 3 cut(s) 439, 542, 636
Bsp143I GATC 8 cut(s) 110, 160, 308, 391, 412, 508, 603, 652
Bsp19I CCATGG 2 cut(s) 440, 544
BspANI GGCC 3 cut(s) 439, 542, 636
BspCNI CTCAG 1 cut(s) 172
BspLI GGNNCC 1 cut(s) 202
BspMAI CTGCAG 1 cut(s) 855
BspPI GGATC 4 cut(s) 155, 316, 386, 647
BsrDI GCAATG 1 cut(s) 461
BsrFI RCCGGY 1 cut(s) 404
BsrI ACTGG 2 cut(s) 638, 671
BssAI RCCGGY 1 cut(s) 404
BssECI CCNNGG 3 cut(s) 440, 544, 860
BssMI GATC 8 cut(s) 110, 160, 308, 391, 412, 508, 603, 652
BssT1I CCWWGG 3 cut(s) 440, 544, 860
Bst2UI CCWGG 1 cut(s) 306
Bst4CI ACNGT 2 cut(s) 146, 818
Bst6I CTCTTC 1 cut(s) 534
BstAPI GCANNNNNTGC 2 cut(s) 239, 820
BstC8I GCNNGC 3 cut(s) 27, 156, 402
BstDEI CTNAG 1 cut(s) 180
BstDSI CCRYGG 2 cut(s) 440, 544
BstF5I GGATG 4 cut(s) 244, 373, 723, 776
BstKTI GATC 8 cut(s) 113, 163, 311, 394, 415, 511, 606, 655
BstMAI GTCTC 1 cut(s) 746
BstMBI GATC 8 cut(s) 110, 160, 308, 391, 412, 508, 603, 652
BstMWI GCNNNNNNNGC 3 cut(s) 230, 239, 820
BstNI CCWGG 1 cut(s) 306
BstNSI RCATGY 2 cut(s) 304, 830
BstSCI CCNGG 1 cut(s) 304
BstSFI CTRYAG 3 cut(s) 106, 798, 851
BstV1I GCAGC 4 cut(s) 547, 835, 837, 865
BstV2I GAAGAC 2 cut(s) 355, 750
BstX2I RGATCY 1 cut(s) 110
BstXI CCANNNNNNTGG 1 cut(s) 385
BstYI RGATCY 1 cut(s) 110
BsuRI GGCC 3 cut(s) 439, 542, 636
BtgI CCRYGG 2 cut(s) 440, 544
BtsCI GGATG 4 cut(s) 244, 373, 723, 776
BtsI GCAGTG 1 cut(s) 266
BtsIMutI CAGTG 1 cut(s) 266
Cac8I GCNNGC 3 cut(s) 27, 156, 402
CaiI CAGNNNCTG 2 cut(s) 506, 755
Cfr10I RCCGGY 1 cut(s) 404
Cfr13I GGNCC 2 cut(s) 541, 635
CviAII CATG 9 cut(s) 19, 218, 301, 441, 545, 714, 736, 827, 847
DdeI CTNAG 1 cut(s) 180
DpnI GATC 8 cut(s) 112, 162, 310, 393, 414, 510, 605, 654
DpnII GATC 8 cut(s) 110, 160, 308, 391, 412, 508, 603, 652
DraIII CACNNNGTG 1 cut(s) 820
Eam1104I CTCTTC 1 cut(s) 534
EarI CTCTTC 1 cut(s) 534
Eco130I CCWWGG 3 cut(s) 440, 544, 860
Eco32I GATATC 1 cut(s) 554
EcoRII CCWGG 1 cut(s) 304
EcoRV GATATC 1 cut(s) 554
EcoT14I CCWWGG 3 cut(s) 440, 544, 860
EcoT22I ATGCAT 1 cut(s) 935
ErhI CCWWGG 3 cut(s) 440, 544, 860
FaeI CATG 9 cut(s) 22, 221, 304, 444, 548, 717, 739, 830, 850
FatI CATG 9 cut(s) 18, 217, 300, 440, 544, 713, 735, 826, 846
FbaI TGATCA 1 cut(s) 508
Fnu4HI GCNGC 4 cut(s) 561, 824, 851, 854
FokI GGATG 4 cut(s) 251, 380, 730, 783
Fsp4HI GCNGC 4 cut(s) 561, 824, 851, 854
FspBI CTAG 1 cut(s) 779
GluI GCNGC 4 cut(s) 561, 824, 851, 854
GsuI CTGGAG 1 cut(s) 654
HaeIII GGCC 3 cut(s) 439, 542, 636
HapII CCGG 1 cut(s) 405
Hin1II CATG 9 cut(s) 22, 221, 304, 444, 548, 717, 739, 830, 850
HindIII AAGCTT 1 cut(s) 762
HinfI GANTC 1 cut(s) 373
HpaII CCGG 1 cut(s) 405
HphI GGTGA 1 cut(s) 24
Hpy188I TCNGA 3 cut(s) 313, 711, 837
Hpy188III TCNNGA 4 cut(s) 172, 345, 410, 682
HpyAV CCTTC 4 cut(s) 289, 574, 679, 832
HpyCH4III ACNGT 2 cut(s) 146, 818
HpyCH4V TGCA 6 cut(s) 340, 454, 814, 823, 853, 933
HpyF10VI GCNNNNNNNGC 3 cut(s) 230, 239, 820
HpyF3I CTNAG 1 cut(s) 180
Hsp92II CATG 9 cut(s) 22, 221, 304, 444, 548, 717, 739, 830, 850
Ksp22I TGATCA 1 cut(s) 508
Kzo9I GATC 8 cut(s) 110, 160, 308, 391, 412, 508, 603, 652
LmnI GCTCC 2 cut(s) 247, 712
Lsp1109I GCAGC 4 cut(s) 547, 835, 837, 865
LweI GCATC 3 cut(s) 165, 229, 812
MaeI CTAG 1 cut(s) 779
MaeIII GTNAC 3 cut(s) 140, 640, 911
MalI GATC 8 cut(s) 112, 162, 310, 393, 414, 510, 605, 654
MboI GATC 8 cut(s) 110, 160, 308, 391, 412, 508, 603, 652
MboII GAAGA 9 cut(s) 25, 301, 304, 360, 494, 521, 613, 755, 824
MfeI CAATTG 2 cut(s) 474, 657
MflI RGATCY 1 cut(s) 110
MluCI AATT 7 cut(s) 333, 474, 535, 657, 664, 675, 873
MmeI TCCRAC 1 cut(s) 734
MnlI CCTC 6 cut(s) 3, 314, 405, 472, 537, 542
Mph1103I ATGCAT 1 cut(s) 935
MroXI GAANNNNTTC 1 cut(s) 842
MseI TTAA 4 cut(s) 227, 431, 582, 923
MslI CAYNNNNRTG 1 cut(s) 383
MspI CCGG 1 cut(s) 405
MspR9I CCNGG 1 cut(s) 306
MunI CAATTG 2 cut(s) 474, 657
Mva1269I GAATGC 1 cut(s) 340
MvaI CCWGG 1 cut(s) 306
MwoI GCNNNNNNNGC 3 cut(s) 230, 239, 820
NcoI CCATGG 2 cut(s) 440, 544
NdeII GATC 8 cut(s) 110, 160, 308, 391, 412, 508, 603, 652
NlaIII CATG 9 cut(s) 22, 221, 304, 444, 548, 717, 739, 830, 850
NlaIV GGNNCC 1 cut(s) 202
NmuCI GTSAC 2 cut(s) 640, 911
NsiI ATGCAT 1 cut(s) 935
NspI RCATGY 2 cut(s) 304, 830
OliI CACNNNNGTG 1 cut(s) 383
PctI GAATGC 1 cut(s) 340
PdmI GAANNNNTTC 1 cut(s) 842
PfeI GAWTC 1 cut(s) 373
PkrI GCNGC 4 cut(s) 562, 825, 852, 855
PsiI TTATAA 1 cut(s) 521
Psp6I CCWGG 1 cut(s) 304
PspGI CCWGG 1 cut(s) 304
PspN4I GGNNCC 1 cut(s) 202
PspPI GGNCC 2 cut(s) 541, 635
PstI CTGCAG 1 cut(s) 855
PstNI CAGNNNCTG 2 cut(s) 506, 755
PsuI RGATCY 1 cut(s) 110
RseI CAYNNNNRTG 1 cut(s) 383
SaqAI TTAA 4 cut(s) 227, 431, 582, 923
SatI GCNGC 4 cut(s) 561, 824, 851, 854
Sau3AI GATC 8 cut(s) 110, 160, 308, 391, 412, 508, 603, 652
Sau96I GGNCC 2 cut(s) 541, 635
ScrFI CCNGG 1 cut(s) 306
SetI ASST 6 cut(s) 133, 202, 355, 589, 766, 930
SfaNI GCATC 3 cut(s) 165, 229, 812
SfcI CTRYAG 3 cut(s) 106, 798, 851
SmiMI CAYNNNNRTG 1 cut(s) 383
Sse9I AATT 7 cut(s) 333, 474, 535, 657, 664, 675, 873
SspI AATATT 2 cut(s) 649, 724
SspMI CTAG 1 cut(s) 779
StyD4I CCNGG 1 cut(s) 304
StyI CCWWGG 3 cut(s) 440, 544, 860
TaaI ACNGT 2 cut(s) 146, 818
TaqI TCGA 2 cut(s) 171, 331
TasI AATT 7 cut(s) 333, 474, 535, 657, 664, 675, 873
TfiI GAWTC 1 cut(s) 373
Tru1I TTAA 4 cut(s) 227, 431, 582, 923
Tru9I TTAA 4 cut(s) 227, 431, 582, 923
TscAI CASTG 1 cut(s) 266
TseFI GTSAC 2 cut(s) 640, 911
TseI GCWGC 4 cut(s) 560, 823, 850, 853
Tsp45I GTSAC 2 cut(s) 640, 911
TspDTI ATGAA 3 cut(s) 734, 752, 835
TspGWI ACGGA 1 cut(s) 251
TspRI CASTG 1 cut(s) 266
XapI RAATTY 2 cut(s) 333, 664
XceI RCATGY 2 cut(s) 304, 830
XmnI GAANNNNTTC 1 cut(s) 842
XspI CTAG 1 cut(s) 779
Zsp2I ATGCAT 1 cut(s) 935
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.