Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr5A

Orthogroup ID

OG0002578

Physical Location & Seq

Genomic Coordinates Reverse (-)

53420041 .. 53435617

Gene Structure 15577 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh5AG334100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 153 bp

ATGAAGTTTTATGTTTCTCTGCCTATGGCTTTAGTTGCTATACTTCGTAGCTTCATATACCTAGCAGGCGTTGAAAAACCTCCGAACTCTTTGTCGTCGTCTCTCATTACTCAGTTGTTCAGTTCTCAGGTGGGTCTTGCTCTTTCTTCTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

50

Amino Acids

5.38

Weight (kDa)

9.52

Isoelectric Point (pI)

54.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002578)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G25260 AT5G13500 AT5G13500 AT5G13500
fragaria_vesca	FvH4_7g03230
malus_domestica	MD02G1284100.v1.1 MD03G1165800.v1.1 MD07G1050100.v1.1
prunus_persica	Prupe.2G038500_v2.0.a1 Prupe.2G038500_v2.0.a1 Prupe.2G038500_v2.0.a1 Prupe.4G266100_v2.0.a1 Prupe.4G266100_v2.0.a1
pyrus_communis	pycom02g24210 pycom03g12050 pycom07g03590
rosa_chinensis	RchiOBHm_Chr1g0325271 RchiOBHm_Chr5g0050591
rosa_laevigata	RLG00000030148 RLG00000034710
rosa_multiflora	Rmu_sc0001654.1_g000029 Rmu_sc0001954.1_g000008 Rmu_sc0007742.1_g000031
rosa_roxburghii	Rroxscaffold_1G00030260 Rroxscaffold_4G00324840
rosa_rugosa	Rorug01G0050900 Rorug01G0051000 Rorug01G0051100 Rorug05G0262100
rosa_samantha	Rh1AG066300 Rh1BG054400 Rh1CG067700 Rh1DG072500 Rh5AG334000 Rh5AG334100 Rh5BG343600 Rh5CG371200 Rh5DG356400
rosa_wichuraiana	Rw1G005540 Rw5G031510

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	74
AluBI	AGCT	1 cut(s)	51
AluI	AGCT	1 cut(s)	51
Alw26I	GTCTC	1 cut(s)	105
ArsI	GACNNNNNNTTYG	2 cut(s)	77, 109
BcoDI	GTCTC	1 cut(s)	105
BfaI	CTAG	1 cut(s)	62
BseMII	CTCAG	2 cut(s)	125, 140
BsmAI	GTCTC	1 cut(s)	105
BsmBI	CGTCTC	1 cut(s)	105
BspCNI	CTCAG	2 cut(s)	124, 139
BstC8I	GCNNGC	1 cut(s)	67
BstDEI	CTNAG	3 cut(s)	111, 126, 150
BstMAI	GTCTC	1 cut(s)	105
BstMWI	GCNNNNNNNGC	1 cut(s)	35
Cac8I	GCNNGC	1 cut(s)	67
CviJI	RGCY	2 cut(s)	29, 51
CviKI_1	RGCY	2 cut(s)	29, 51
DdeI	CTNAG	3 cut(s)	111, 126, 150
Esp3I	CGTCTC	1 cut(s)	105
FaiI	YATR	5 cut(s)	12, 26, 41, 56, 58
FspBI	CTAG	1 cut(s)	62
FspEI	CC	9 cut(s)	11, 36, 51, 74, 93, 96, 113, 116, 117
Hpy188I	TCNGA	1 cut(s)	84
Hpy99I	CGWCG	1 cut(s)	100
HpyF10VI	GCNNNNNNNGC	1 cut(s)	35
HpyF3I	CTNAG	3 cut(s)	111, 126, 150
LpnPI	CCDG	2 cut(s)	51, 113
MaeI	CTAG	1 cut(s)	62
MboII	GAAGA	1 cut(s)	138
MnlI	CCTC	1 cut(s)	90
MwoI	GCNNNNNNNGC	1 cut(s)	35
SetI	ASST	4 cut(s)	53, 63, 82, 132
SgeI	CNNG	4 cut(s)	74, 78, 140, 149
SspMI	CTAG	1 cut(s)	62
TspDTI	ATGAA	2 cut(s)	17, 43
XspI	CTAG	1 cut(s)	62

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.