Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007742.1

Orthogroup ID

OG0002578

Physical Location & Seq

Genomic Coordinates Forward (+)

111482 .. 115141

Gene Structure 3660 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007742.1_g000031.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1104 bp

atgattgggaggaagaacatggggcgtgcttcaccattacttctgtttctcttggcttttgggtttttctttgccacttacaatcttttgacgatgatactccactatagatctgttgggaagtgggtaggtggtaatagtaacagtcatttgctggctgaccccattgtcgagatgcctgagaatgtgaaagtcaaaggttccaaagcaccattccatgttgccttaacagcaacggatgctccttatagtaaatggcagtgtcgcattatgtattattggtataagaagaagaaggagatgcctggatcagaaatgggaggatttactcgaattttgcattcgggaagacctgacaacttgatggatgagattcccactatggtggttgatcctctgcctgccggtcttgatcggggatatattgtcttaaataggccatgggcttttgtgcaatggctggaaaaggctacaattgaggaagaatatgtgttgatggcagagcctgatcatatatttataaatcctcttcctaatttggcccatggaggatatcctgctgccttcccctttttctacattaaacctacacagaatgagaagatcataagaaagttttaccccaaagagaatggcccagtcacaaatattgatccaattggaaattctccagtaattatcaagaaggatatgctggaaaagattgctccgacatggatgaatatttctttgagcatgaaagaagacacagagactgataaagcttttggatgggtgctagaaatgtatgcttatgctgtagcatctgctttgcacggtgtgcagcatgttcttcggaaggacttcatgctgcagcccccttgggatttggaaattggtaaaaagtttattattcactacacttatgggtgtgactacaacttaaagggtgagctcacatatggcaaaattggggagtggagatttgataagagatcatatctgcatggacctctgccgagaaaccttcctttaccccctcctggggttcctgagagtgtggccacccttgtaaagatggtgaacgaagctactgctaaccttcctaattgggacacacaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005794 GO:0005802 GO:0012505 GO:0016740 GO:0016757 GO:0016763 GO:0031410 GO:0031982 GO:0031984 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044431 GO:0044444 GO:0044446 GO:0044464 GO:0097708 GO:0098791 GO:1990585

KEGG Pathways

Metabolic & Signaling

ko00514 map00514

Pfam Domains

Protein Families

No domains found.

Protein Analysis

367

Amino Acids

41.86

Weight (kDa)

8.55

Isoelectric Point (pI)

41.48

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002578)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G25260 AT5G13500 AT5G13500 AT5G13500
fragaria_vesca	FvH4_7g03230
malus_domestica	MD02G1284100.v1.1 MD03G1165800.v1.1 MD07G1050100.v1.1
prunus_persica	Prupe.2G038500_v2.0.a1 Prupe.2G038500_v2.0.a1 Prupe.2G038500_v2.0.a1 Prupe.4G266100_v2.0.a1 Prupe.4G266100_v2.0.a1
pyrus_communis	pycom02g24210 pycom03g12050 pycom07g03590
rosa_chinensis	RchiOBHm_Chr1g0325271 RchiOBHm_Chr5g0050591
rosa_laevigata	RLG00000030148 RLG00000034710
rosa_multiflora	Rmu_sc0001654.1_g000029 Rmu_sc0001954.1_g000008 Rmu_sc0007742.1_g000031
rosa_roxburghii	Rroxscaffold_1G00030260 Rroxscaffold_4G00324840
rosa_rugosa	Rorug01G0050900 Rorug01G0051000 Rorug01G0051100 Rorug05G0262100
rosa_samantha	Rh1AG066300 Rh1BG054400 Rh1CG067700 Rh1DG072500 Rh5AG334000 Rh5AG334100 Rh5BG343600 Rh5CG371200 Rh5DG356400
rosa_wichuraiana	Rw1G005540 Rw5G031510

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	521
AasI	GACNNNNNNGTC	1 cut(s)	167
AclWI	GGATC	3 cut(s)	316, 386, 647
AcoI	YGGCCR	1 cut(s)	1041
AcsI	RAATTY	2 cut(s)	333, 664
AdeI	CACNNNGTG	1 cut(s)	820
AfiI	CCNNNNNNNGG	3 cut(s)	1022, 1023, 1024
AjnI	CCWGG	2 cut(s)	304, 1021
AjuI	GAANNNNNNNTTGG	4 cut(s)	197, 229, 649, 681
AleI	CACNNNNGTG	1 cut(s)	383
AluBI	AGCT	3 cut(s)	764, 934, 1070
AluI	AGCT	3 cut(s)	764, 934, 1070
Alw21I	GWGCWC	1 cut(s)	936
Alw26I	GTCTC	1 cut(s)	746
AlwI	GGATC	3 cut(s)	316, 386, 647
AlwNI	CAGNNNCTG	2 cut(s)	506, 755
AoxI	GGCC	4 cut(s)	437, 540, 634, 1041
ApeKI	GCWGC	4 cut(s)	560, 823, 850, 853
ApoI	RAATTY	2 cut(s)	333, 664
Asp700I	GAANNNNTTC	1 cut(s)	842
AspS9I	GGNCC	3 cut(s)	541, 635, 989
AsuHPI	GGTGA	3 cut(s)	24, 941, 1072
AvaII	GGWCC	1 cut(s)	989
BalI	TGGCCA	1 cut(s)	1043
BanII	GRGCYC	1 cut(s)	936
BbsI	GAAGAC	2 cut(s)	355, 750
Bbv12I	GWGCWC	1 cut(s)	936
BbvI	GCAGC	4 cut(s)	547, 835, 837, 865
BccI	CCATC	4 cut(s)	358, 490, 765, 1051
BcgI	CGANNNNNNTGC	4 cut(s)	815, 849, 1055, 1089
BciT130I	CCWGG	2 cut(s)	306, 1023
BclI	TGATCA	1 cut(s)	508
BcoDI	GTCTC	1 cut(s)	746
BfaI	CTAG	1 cut(s)	779
BfmI	CTRYAG	3 cut(s)	106, 798, 851
BglII	AGATCT	1 cut(s)	110
BisI	GCNGC	4 cut(s)	561, 824, 851, 854
BlsI	GCNGC	4 cut(s)	562, 825, 852, 855
Bme1390I	CCNGG	2 cut(s)	306, 1023
Bme18I	GGWCC	1 cut(s)	989
BmgT120I	GGNCC	3 cut(s)	541, 635, 989
BmiI	GGNNCC	2 cut(s)	202, 1029
BmrFI	CCNGG	2 cut(s)	306, 1023
BmrI	ACTGGG	1 cut(s)	632
BmsI	GCATC	4 cut(s)	165, 229, 291, 812
BmuI	ACTGGG	1 cut(s)	632
BpiI	GAAGAC	2 cut(s)	355, 750
BpmI	CTGGAG	1 cut(s)	654
BsaJI	CCNNGG	4 cut(s)	440, 544, 860, 1022
BsaXI	ACNNNNNCTCC	2 cut(s)	226, 256
Bsc4I	CCNNNNNNNGG	3 cut(s)	1022, 1023, 1024
Bse118I	RCCGGY	1 cut(s)	404
Bse1I	ACTGG	2 cut(s)	638, 671
Bse3DI	GCAATG	1 cut(s)	461
BseBI	CCWGG	2 cut(s)	306, 1023
BseDI	CCNNGG	4 cut(s)	440, 544, 860, 1022
BseGI	GGATG	4 cut(s)	244, 373, 723, 776
BseLI	CCNNNNNNNGG	3 cut(s)	1022, 1023, 1024
BseMI	GCAATG	1 cut(s)	461
BseMII	CTCAG	2 cut(s)	171, 1023
BseNI	ACTGG	2 cut(s)	638, 671
BseXI	GCAGC	4 cut(s)	547, 835, 837, 865
BsgI	GTGCAG	1 cut(s)	842
BshFI	GGCC	4 cut(s)	439, 542, 636, 1043
BsiHKAI	GWGCWC	1 cut(s)	936
BsiSI	CCGG	1 cut(s)	405
BslI	CCNNNNNNNGG	3 cut(s)	1022, 1023, 1024
BsmAI	GTCTC	1 cut(s)	746
BsmI	GAATGC	1 cut(s)	340
BsnI	GGCC	4 cut(s)	439, 542, 636, 1043
Bsp1286I	GDGCHC	1 cut(s)	936
Bsp143I	GATC	8 cut(s)	110, 308, 391, 412, 508, 603, 652, 974
Bsp19I	CCATGG	2 cut(s)	440, 544
BspANI	GGCC	4 cut(s)	439, 542, 636, 1043
BspCNI	CTCAG	2 cut(s)	172, 1024
BspLI	GGNNCC	2 cut(s)	202, 1029
BspMAI	CTGCAG	1 cut(s)	855
BspPI	GGATC	3 cut(s)	316, 386, 647
BsrDI	GCAATG	1 cut(s)	461
BsrFI	RCCGGY	1 cut(s)	404
BsrI	ACTGG	2 cut(s)	638, 671
BssAI	RCCGGY	1 cut(s)	404
BssECI	CCNNGG	4 cut(s)	440, 544, 860, 1022
BssMI	GATC	8 cut(s)	110, 308, 391, 412, 508, 603, 652, 974
BssT1I	CCWWGG	3 cut(s)	440, 544, 860
Bst2UI	CCWGG	2 cut(s)	306, 1023
Bst4CI	ACNGT	2 cut(s)	146, 818
Bst6I	CTCTTC	1 cut(s)	534
BstAPI	GCANNNNNTGC	2 cut(s)	239, 820
BstC8I	GCNNGC	3 cut(s)	27, 156, 402
BstDEI	CTNAG	2 cut(s)	180, 1032
BstDSI	CCRYGG	2 cut(s)	440, 544
BstF5I	GGATG	4 cut(s)	244, 373, 723, 776
BstKTI	GATC	8 cut(s)	113, 311, 394, 415, 511, 606, 655, 977
BstMAI	GTCTC	1 cut(s)	746
BstMBI	GATC	8 cut(s)	110, 308, 391, 412, 508, 603, 652, 974
BstMWI	GCNNNNNNNGC	3 cut(s)	230, 239, 820
BstNI	CCWGG	2 cut(s)	306, 1023
BstNSI	RCATGY	1 cut(s)	830
BstSCI	CCNGG	2 cut(s)	304, 1021
BstSFI	CTRYAG	3 cut(s)	106, 798, 851
BstV1I	GCAGC	4 cut(s)	547, 835, 837, 865
BstV2I	GAAGAC	2 cut(s)	355, 750
BstX2I	RGATCY	1 cut(s)	110
BstXI	CCANNNNNNTGG	1 cut(s)	385
BstYI	RGATCY	1 cut(s)	110
BsuRI	GGCC	4 cut(s)	439, 542, 636, 1043
BtgI	CCRYGG	2 cut(s)	440, 544
BtsCI	GGATG	4 cut(s)	244, 373, 723, 776
BtsI	GCAGTG	1 cut(s)	266
BtsIMutI	CAGTG	1 cut(s)	266
Cac8I	GCNNGC	3 cut(s)	27, 156, 402
CaiI	CAGNNNCTG	2 cut(s)	506, 755
Cfr10I	RCCGGY	1 cut(s)	404
Cfr13I	GGNCC	3 cut(s)	541, 635, 989
CviAII	CATG	9 cut(s)	19, 218, 441, 545, 714, 736, 827, 847, 986
DdeI	CTNAG	2 cut(s)	180, 1032
DpnI	GATC	8 cut(s)	112, 310, 393, 414, 510, 605, 654, 976
DpnII	GATC	8 cut(s)	110, 308, 391, 412, 508, 603, 652, 974
DraIII	CACNNNGTG	1 cut(s)	820
DrdI	GACNNNNNNGTC	1 cut(s)	167
DseDI	GACNNNNNNGTC	1 cut(s)	167
EaeI	YGGCCR	1 cut(s)	1041
Eam1104I	CTCTTC	1 cut(s)	534
EarI	CTCTTC	1 cut(s)	534
Ecl136II	GAGCTC	1 cut(s)	934
Eco130I	CCWWGG	3 cut(s)	440, 544, 860
Eco24I	GRGCYC	1 cut(s)	936
Eco32I	GATATC	1 cut(s)	554
Eco47I	GGWCC	1 cut(s)	989
Eco53kI	GAGCTC	1 cut(s)	934
EcoICRI	GAGCTC	1 cut(s)	934
EcoRII	CCWGG	2 cut(s)	304, 1021
EcoRV	GATATC	1 cut(s)	554
EcoT14I	CCWWGG	3 cut(s)	440, 544, 860
EcoT38I	GRGCYC	1 cut(s)	936
ErhI	CCWWGG	3 cut(s)	440, 544, 860
FaeI	CATG	9 cut(s)	22, 221, 444, 548, 717, 739, 830, 850, 989
FatI	CATG	9 cut(s)	18, 217, 440, 544, 713, 735, 826, 846, 985
FauNDI	CATATG	1 cut(s)	940
FbaI	TGATCA	1 cut(s)	508
Fnu4HI	GCNGC	4 cut(s)	561, 824, 851, 854
FokI	GGATG	4 cut(s)	251, 380, 730, 783
FriOI	GRGCYC	1 cut(s)	936
Fsp4HI	GCNGC	4 cut(s)	561, 824, 851, 854
FspBI	CTAG	1 cut(s)	779
GluI	GCNGC	4 cut(s)	561, 824, 851, 854
GsuI	CTGGAG	1 cut(s)	654
HaeIII	GGCC	4 cut(s)	439, 542, 636, 1043
HapII	CCGG	1 cut(s)	405
Hin1II	CATG	9 cut(s)	22, 221, 444, 548, 717, 739, 830, 850, 989
HindIII	AAGCTT	1 cut(s)	762
HinfI	GANTC	1 cut(s)	373
HpaII	CCGG	1 cut(s)	405
HphI	GGTGA	3 cut(s)	24, 941, 1072
Hpy166II	GTNNAC	1 cut(s)	1063
Hpy188I	TCNGA	3 cut(s)	313, 711, 837
Hpy188III	TCNNGA	5 cut(s)	172, 345, 410, 682, 1031
Hpy8I	GTNNAC	1 cut(s)	1063
HpyAV	CCTTC	6 cut(s)	289, 574, 679, 832, 1016, 1091
HpyCH4III	ACNGT	2 cut(s)	146, 818
HpyCH4V	TGCA	6 cut(s)	340, 454, 814, 823, 853, 985
HpyF10VI	GCNNNNNNNGC	3 cut(s)	230, 239, 820
HpyF3I	CTNAG	2 cut(s)	180, 1032
Hsp92II	CATG	9 cut(s)	22, 221, 444, 548, 717, 739, 830, 850, 989
Ksp22I	TGATCA	1 cut(s)	508
Kzo9I	GATC	8 cut(s)	110, 308, 391, 412, 508, 603, 652, 974
LmnI	GCTCC	2 cut(s)	247, 712
Lsp1109I	GCAGC	4 cut(s)	547, 835, 837, 865
LweI	GCATC	4 cut(s)	165, 229, 291, 812
MaeI	CTAG	1 cut(s)	779
MaeIII	GTNAC	3 cut(s)	140, 640, 911
MalI	GATC	8 cut(s)	112, 310, 393, 414, 510, 605, 654, 976
MboI	GATC	8 cut(s)	110, 308, 391, 412, 508, 603, 652, 974
MboII	GAAGA	9 cut(s)	25, 301, 304, 360, 494, 521, 613, 755, 824
MfeI	CAATTG	2 cut(s)	474, 657
MflI	RGATCY	1 cut(s)	110
MhlI	GDGCHC	1 cut(s)	936
MlsI	TGGCCA	1 cut(s)	1043
MluCI	AATT	9 cut(s)	333, 474, 535, 657, 664, 675, 873, 948, 1087
MluNI	TGGCCA	1 cut(s)	1043
MmeI	TCCRAC	1 cut(s)	734
MnlI	CCTC	8 cut(s)	3, 314, 405, 472, 537, 542, 1002, 1029
Mox20I	TGGCCA	1 cut(s)	1043
MroXI	GAANNNNTTC	1 cut(s)	842
MscI	TGGCCA	1 cut(s)	1043
MseI	TTAA	4 cut(s)	227, 431, 582, 923
MslI	CAYNNNNRTG	1 cut(s)	383
Msp20I	TGGCCA	1 cut(s)	1043
MspI	CCGG	1 cut(s)	405
MspR9I	CCNGG	2 cut(s)	306, 1023
MunI	CAATTG	2 cut(s)	474, 657
Mva1269I	GAATGC	1 cut(s)	340
MvaI	CCWGG	2 cut(s)	306, 1023
MwoI	GCNNNNNNNGC	3 cut(s)	230, 239, 820
NcoI	CCATGG	2 cut(s)	440, 544
NdeI	CATATG	1 cut(s)	940
NdeII	GATC	8 cut(s)	110, 308, 391, 412, 508, 603, 652, 974
NlaIII	CATG	9 cut(s)	22, 221, 444, 548, 717, 739, 830, 850, 989
NlaIV	GGNNCC	2 cut(s)	202, 1029
NmeAIII	GCCGAG	1 cut(s)	1023
NmuCI	GTSAC	2 cut(s)	640, 911
NspI	RCATGY	1 cut(s)	830
OliI	CACNNNNGTG	1 cut(s)	383
PctI	GAATGC	1 cut(s)	340
PdmI	GAANNNNTTC	1 cut(s)	842
PfeI	GAWTC	1 cut(s)	373
PkrI	GCNGC	4 cut(s)	562, 825, 852, 855
PsiI	TTATAA	1 cut(s)	521
Psp124BI	GAGCTC	1 cut(s)	936
Psp6I	CCWGG	2 cut(s)	304, 1021
PspGI	CCWGG	2 cut(s)	304, 1021
PspN4I	GGNNCC	2 cut(s)	202, 1029
PspPI	GGNCC	3 cut(s)	541, 635, 989
PstI	CTGCAG	1 cut(s)	855
PstNI	CAGNNNCTG	2 cut(s)	506, 755
PsuI	RGATCY	1 cut(s)	110
RseI	CAYNNNNRTG	1 cut(s)	383
SacI	GAGCTC	1 cut(s)	936
SaqAI	TTAA	4 cut(s)	227, 431, 582, 923
SatI	GCNGC	4 cut(s)	561, 824, 851, 854
Sau3AI	GATC	8 cut(s)	110, 308, 391, 412, 508, 603, 652, 974
Sau96I	GGNCC	3 cut(s)	541, 635, 989
ScrFI	CCNGG	2 cut(s)	306, 1023
SduI	GDGCHC	1 cut(s)	936
SfaNI	GCATC	4 cut(s)	165, 229, 291, 812
SfcI	CTRYAG	3 cut(s)	106, 798, 851
SinI	GGWCC	1 cut(s)	989
SmiMI	CAYNNNNRTG	1 cut(s)	383
Sse9I	AATT	9 cut(s)	333, 474, 535, 657, 664, 675, 873, 948, 1087
SspI	AATATT	2 cut(s)	649, 724
SspMI	CTAG	1 cut(s)	779
SstI	GAGCTC	1 cut(s)	936
StyD4I	CCNGG	2 cut(s)	304, 1021
StyI	CCWWGG	3 cut(s)	440, 544, 860
TaaI	ACNGT	2 cut(s)	146, 818
TaqI	TCGA	2 cut(s)	171, 331
TasI	AATT	9 cut(s)	333, 474, 535, 657, 664, 675, 873, 948, 1087
TfiI	GAWTC	1 cut(s)	373
Tru1I	TTAA	4 cut(s)	227, 431, 582, 923
Tru9I	TTAA	4 cut(s)	227, 431, 582, 923
TscAI	CASTG	1 cut(s)	266
TseFI	GTSAC	2 cut(s)	640, 911
TseI	GCWGC	4 cut(s)	560, 823, 850, 853
Tsp45I	GTSAC	2 cut(s)	640, 911
TspDTI	ATGAA	3 cut(s)	734, 752, 835
TspGWI	ACGGA	1 cut(s)	251
TspRI	CASTG	1 cut(s)	266
VpaK11BI	GGWCC	1 cut(s)	989
XapI	RAATTY	2 cut(s)	333, 664
XceI	RCATGY	1 cut(s)	830
XmnI	GAANNNNTTC	1 cut(s)	842
XspI	CTAG	1 cut(s)	779

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.