Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001733.1

Orthogroup ID

OG0006952

Physical Location & Seq

Genomic Coordinates Reverse (-)

42062 .. 43288

Gene Structure 1227 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001733.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1227 bp

atgtccgacctatacttcagtggccgctatctacttcatcataagcaaccactgccacttactctgataaacaaaagaggagaaaccttccctattaaattgactccttcatctcccaagtttctatctaggcttttcaaaagactcatgagtgtcatgtccctgacatgcgagccagtagtggtaggggcgtctaatgacgtgattttgtgctgtgcaactgagtattttcaacgtgattactatatttgcaatccatatagcatacaatgggttaatcttcctcccccctctcgagtcctccatcacgtaccagttggatttatatgtgatccctattataattatattaagaaagacaaagacaatgtgcatcgtcgaagagaaaagagtacaatcatcgatgatggcaatgaggagctaattagtatgaataactggtataggtgcaaggttgtgagaatccttccttatgacgacacatgtggagacgaactttcctccaaatttaagctagatgtctactcttttgagacatgtgaatggagagagtcaattatatcattcccacgaagatttcgttttgatagaatcaactcggatattcacttttctcacaacgaaatgttatattggtccagtatctggggaggcagtaactttctgattgtgttggacccattcatgatcaacgacaataacatcaataccaataattctagcattagctccggtgaagatcatgcctatcactatgaaggtcgtttcattgaattagtagttaaacaccctgttgatgatccgttagacaatccagatgaacataactatcagatacatggcctagccgtgcagtccggaggtggaggatgtctgcaaatgtgtgtcttagactctattgacaacatcatattggtttgggagttgaaagaagaaaaagatctgatcattgcgggcgatggggctggaatattgtgttcgagagaagaagatatttgggtgaatacggcgaaacaagtggagctgataggcttcaacccagatattgagggtttcttgtacgtaagactcgatggagttgatggagttgatggagcttgcatttttgagatcaacgttcgtactagagtggcaaaagaggtggacatgggtggaaagagtgtaatgagtaacaattgcttcttcccaataaaagtggatccatggtggccgacaccagttccttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box

Protein Analysis

408

Amino Acids

46.9

Weight (kDa)

5.2

Isoelectric Point (pI)

44.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006952)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g31431
rosa_chinensis	RchiOBHm_Chr1g0380481
rosa_laevigata	RLG00000001340 RLG00000002701 RLG00000026293 RLG00000026297
rosa_multiflora	Rmu_sc0000945.1_g000007 Rmu_sc0001733.1_g000007 Rmu_sc0006267.1_g000004
rosa_roxburghii	Rroxscaffold_3G00228330 Rroxscaffold_3G00228570 Rroxscaffold_3G00244720 Rroxscaffold_4G00279310 Rroxscaffold_4G00279330
rosa_rugosa	Rorug07G0270400
rosa_samantha	Rh1CG415600 Rh1DG431400 Rh7AG286300 Rh7AG425300 Rh7AG425800 Rh7DG289700 Rh7DG416900 Rh7DG417100
rosa_wichuraiana	Rw7G035160 Rw7G035250 Rw7G035290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	342
AccB7I	CCANNNNNTGG	1 cut(s)	645
AccI	GTMKAC	1 cut(s)	522
AccIII	TCCGGA	1 cut(s)	857
AciI	CCGC	2 cut(s)	25, 953
AclI	AACGTT	1 cut(s)	1116
AclWI	GGATC	4 cut(s)	326, 794, 1193, 1206
AcoI	YGGCCR	2 cut(s)	22, 1208
AcsI	RAATTY	1 cut(s)	506
AcyI	GRCGYC	1 cut(s)	191
AfaI	GTAC	4 cut(s)	312, 394, 1061, 1123
AfiI	CCNNNNNNNGG	1 cut(s)	645
AflIII	ACRYGT	2 cut(s)	482, 536
AgsI	TTSAA	5 cut(s)	139, 233, 773, 928, 1036
AjiI	CACGTC	1 cut(s)	202
AluBI	AGCT	5 cut(s)	421, 514, 729, 1024, 1097
AluI	AGCT	5 cut(s)	421, 514, 729, 1024, 1097
Alw26I	GTCTC	2 cut(s)	483, 527
AlwI	GGATC	4 cut(s)	326, 794, 1193, 1206
AlwNI	CAGNNNCTG	1 cut(s)	645
Ama87I	CYCGRG	1 cut(s)	294
Aor13HI	TCCGGA	1 cut(s)	857
AoxI	GGCC	3 cut(s)	22, 841, 1208
ApoI	RAATTY	1 cut(s)	506
AspS9I	GGNCC	2 cut(s)	636, 676
AsuHPI	GGTGA	2 cut(s)	746, 1012
AvaI	CYCGRG	1 cut(s)	294
AvaII	GGWCC	2 cut(s)	636, 676
BamHI	GGATCC	1 cut(s)	1198
BccI	CCATC	6 cut(s)	312, 401, 953, 1067, 1076, 1085
BceAI	ACGGC	2 cut(s)	833, 1023
BclI	TGATCA	2 cut(s)	687, 945
BcoDI	GTCTC	2 cut(s)	483, 527
BfaI	CTAG	5 cut(s)	129, 515, 720, 845, 1125
BglII	AGATCT	1 cut(s)	940
BisI	GCNGC	1 cut(s)	25
BlsI	GCNGC	1 cut(s)	26
Bme18I	GGWCC	2 cut(s)	636, 676
BmeT110I	CYCGRG	1 cut(s)	294
BmgBI	CACGTC	1 cut(s)	202
BmgT120I	GGNCC	2 cut(s)	636, 676
BmiI	GGNNCC	2 cut(s)	678, 1200
BmsI	GCATC	1 cut(s)	382
Bsa29I	ATCGAT	1 cut(s)	402
BsaAI	YACGTR	2 cut(s)	310, 1063
BsaHI	GRCGYC	1 cut(s)	191
BsaJI	CCNNGG	1 cut(s)	1202
BsaWI	WCCGGW	2 cut(s)	731, 857
Bsc4I	CCNNNNNNNGG	1 cut(s)	645
Bse1I	ACTGG	5 cut(s)	176, 314, 443, 639, 1217
Bse3DI	GCAATG	2 cut(s)	418, 948
BseAI	TCCGGA	1 cut(s)	857
BseCI	ATCGAT	1 cut(s)	402
BseDI	CCNNGG	1 cut(s)	1202
BseGI	GGATG	1 cut(s)	875
BseLI	CCNNNNNNNGG	1 cut(s)	645
BseMI	GCAATG	2 cut(s)	418, 948
BseMII	CTCAG	1 cut(s)	213
BseNI	ACTGG	5 cut(s)	176, 314, 443, 639, 1217
BseRI	GAGGAG	2 cut(s)	93, 431
BsgI	GTGCAG	1 cut(s)	872
BshFI	GGCC	3 cut(s)	24, 843, 1210
BshVI	ATCGAT	1 cut(s)	402
BsiHKCI	CYCGRG	1 cut(s)	294
BsiSI	CCGG	2 cut(s)	732, 858
BslFI	GGGAC	1 cut(s)	145
BslI	CCNNNNNNNGG	1 cut(s)	645
BsmAI	GTCTC	2 cut(s)	483, 527
BsmBI	CGTCTC	1 cut(s)	483
BsmFI	GGGAC	1 cut(s)	145
BsnI	GGCC	3 cut(s)	24, 843, 1210
BsoBI	CYCGRG	1 cut(s)	294
Bsp13I	TCCGGA	1 cut(s)	857
Bsp143I	GATC	8 cut(s)	331, 687, 739, 799, 940, 945, 1110, 1198
Bsp19I	CCATGG	1 cut(s)	1202
BspACI	CCGC	2 cut(s)	25, 953
BspANI	GGCC	3 cut(s)	24, 843, 1210
BspCNI	CTCAG	1 cut(s)	214
BspDI	ATCGAT	1 cut(s)	402
BspEI	TCCGGA	1 cut(s)	857
BspHI	TCATGA	2 cut(s)	147, 684
BspLI	GGNNCC	2 cut(s)	678, 1200
BspPI	GGATC	4 cut(s)	326, 794, 1193, 1206
BsrDI	GCAATG	2 cut(s)	418, 948
BsrI	ACTGG	5 cut(s)	176, 314, 443, 639, 1217
BssECI	CCNNGG	1 cut(s)	1202
BssMI	GATC	8 cut(s)	331, 687, 739, 799, 940, 945, 1110, 1198
BssNI	GRCGYC	1 cut(s)	191
BssT1I	CCWWGG	1 cut(s)	1202
Bst6I	CTCTTC	1 cut(s)	376
BstACI	GRCGYC	1 cut(s)	191
BstAPI	GCANNNNNTGC	1 cut(s)	52
BstBAI	YACGTR	2 cut(s)	310, 1063
BstC8I	GCNNGC	3 cut(s)	173, 955, 1099
BstDEI	CTNAG	2 cut(s)	222, 889
BstDSI	CCRYGG	1 cut(s)	1202
BstF5I	GGATG	1 cut(s)	875
BstKTI	GATC	8 cut(s)	334, 690, 742, 802, 943, 948, 1113, 1201
BstMAI	GTCTC	2 cut(s)	483, 527
BstMBI	GATC	8 cut(s)	331, 687, 739, 799, 940, 945, 1110, 1198
BstMWI	GCNNNNNNNGC	1 cut(s)	52
BstNSI	RCATGY	3 cut(s)	171, 486, 540
BstSNI	TACGTA	1 cut(s)	1063
BstX2I	RGATCY	2 cut(s)	940, 1198
BstYI	RGATCY	2 cut(s)	940, 1198
Bsu15I	ATCGAT	1 cut(s)	402
BsuRI	GGCC	3 cut(s)	24, 843, 1210
BsuTUI	ATCGAT	1 cut(s)	402
BtgI	CCRYGG	1 cut(s)	1202
BtgZI	GCGATG	1 cut(s)	972
BtrI	CACGTC	1 cut(s)	202
BtsCI	GGATG	1 cut(s)	875
BtsI	GCAGTG	1 cut(s)	50
BtsIMutI	CAGTG	2 cut(s)	25, 50
Cac8I	GCNNGC	3 cut(s)	173, 955, 1099
CaiI	CAGNNNCTG	1 cut(s)	645
CciI	TCATGA	2 cut(s)	147, 684
Cfr13I	GGNCC	2 cut(s)	636, 676
ClaI	ATCGAT	1 cut(s)	402
CseI	GACGC	1 cut(s)	180
Csp6I	GTAC	4 cut(s)	311, 393, 1060, 1122
CspCI	CAANNNNNGTGG	4 cut(s)	1122, 1157, 1176, 1211
CviQI	GTAC	4 cut(s)	311, 393, 1060, 1122
DdeI	CTNAG	2 cut(s)	222, 889
DpnI	GATC	8 cut(s)	333, 689, 741, 801, 942, 947, 1112, 1200
DpnII	GATC	8 cut(s)	331, 687, 739, 799, 940, 945, 1110, 1198
EaeI	YGGCCR	2 cut(s)	22, 1208
Eam1104I	CTCTTC	1 cut(s)	376
EarI	CTCTTC	1 cut(s)	376
Eco105I	TACGTA	1 cut(s)	1063
Eco130I	CCWWGG	1 cut(s)	1202
Eco47I	GGWCC	2 cut(s)	636, 676
Eco88I	CYCGRG	1 cut(s)	294
EcoT14I	CCWWGG	1 cut(s)	1202
ErhI	CCWWGG	1 cut(s)	1202
Esp3I	CGTCTC	1 cut(s)	483
FaqI	GGGAC	1 cut(s)	145
FauI	CCCGC	1 cut(s)	946
FbaI	TGATCA	2 cut(s)	687, 945
FblI	GTMKAC	1 cut(s)	522
Fnu4HI	GCNGC	1 cut(s)	25
FokI	GGATG	1 cut(s)	882
Fsp4HI	GCNGC	1 cut(s)	25
FspBI	CTAG	5 cut(s)	129, 515, 720, 845, 1125
GluI	GCNGC	1 cut(s)	25
HaeIII	GGCC	3 cut(s)	24, 843, 1210
HapII	CCGG	2 cut(s)	732, 858
HgaI	GACGC	1 cut(s)	180
Hin1I	GRCGYC	1 cut(s)	191
HinfI	GANTC	8 cut(s)	103, 144, 297, 462, 551, 591, 893, 1068
HpaII	CCGG	2 cut(s)	732, 858
HphI	GGTGA	2 cut(s)	746, 1012
Hpy166II	GTNNAC	2 cut(s)	523, 1144
Hpy188I	TCNGA	6 cut(s)	7, 66, 601, 666, 834, 945
Hpy188III	TCNNGA	6 cut(s)	148, 294, 685, 815, 858, 981
Hpy8I	GTNNAC	2 cut(s)	523, 1144
Hpy99I	CGWCG	1 cut(s)	381
HpyAV	CCTTC	4 cut(s)	97, 117, 476, 752
HpyCH4IV	ACGT	5 cut(s)	201, 235, 309, 1062, 1116
HpyCH4V	TGCA	7 cut(s)	218, 252, 373, 450, 853, 877, 1101
HpyF10VI	GCNNNNNNNGC	1 cut(s)	52
HpyF3I	CTNAG	2 cut(s)	222, 889
HpySE526I	ACGT	5 cut(s)	201, 235, 309, 1062, 1116
Hsp92I	GRCGYC	1 cut(s)	191
Kpn2I	TCCGGA	1 cut(s)	857
Ksp22I	TGATCA	2 cut(s)	687, 945
Kzo9I	GATC	8 cut(s)	331, 687, 739, 799, 940, 945, 1110, 1198
LmnI	GCTCC	4 cut(s)	418, 734, 1021, 1094
LweI	GCATC	1 cut(s)	382
MaeI	CTAG	5 cut(s)	129, 515, 720, 845, 1125
MaeII	ACGT	5 cut(s)	201, 235, 309, 1062, 1116
MaeIII	GTNAC	2 cut(s)	656, 1169
MalI	GATC	8 cut(s)	333, 689, 741, 801, 942, 947, 1112, 1200
MboI	GATC	8 cut(s)	331, 687, 739, 799, 940, 945, 1110, 1198
MboII	GAAGA	8 cut(s)	272, 393, 585, 749, 944, 998, 1001, 1174
MfeI	CAATTG	1 cut(s)	1174
MflI	RGATCY	2 cut(s)	940, 1198
MluCI	AATT	8 cut(s)	98, 343, 423, 506, 555, 715, 773, 1174
MlyI	GAGTC	6 cut(s)	97, 138, 306, 560, 887, 1062
MmeI	TCCRAC	3 cut(s)	30, 298, 654
MroI	TCCGGA	1 cut(s)	857
MseI	TTAA	5 cut(s)	96, 276, 351, 510, 783
MslI	CAYNNNNRTG	1 cut(s)	541
MspI	CCGG	2 cut(s)	732, 858
MunI	CAATTG	1 cut(s)	1174
MwoI	GCNNNNNNNGC	1 cut(s)	52
NcoI	CCATGG	1 cut(s)	1202
NdeII	GATC	8 cut(s)	331, 687, 739, 799, 940, 945, 1110, 1198
NlaIV	GGNNCC	2 cut(s)	678, 1200
NspI	RCATGY	3 cut(s)	171, 486, 540
PaeR7I	CTCGAG	1 cut(s)	294
PagI	TCATGA	2 cut(s)	147, 684
PciI	ACATGT	2 cut(s)	482, 536
PcsI	WCGNNNNNNNCGW	2 cut(s)	577, 1068
PfeI	GAWTC	2 cut(s)	462, 591
PflMI	CCANNNNNTGG	1 cut(s)	645
PkrI	GCNGC	1 cut(s)	26
PleI	GAGTC	6 cut(s)	97, 138, 305, 559, 887, 1062
PpsI	GAGTC	6 cut(s)	97, 138, 305, 559, 887, 1062
Ppu21I	YACGTR	2 cut(s)	310, 1063
PscI	ACATGT	2 cut(s)	482, 536
PsiI	TTATAA	1 cut(s)	342
Psp1406I	AACGTT	1 cut(s)	1116
PspN4I	GGNNCC	2 cut(s)	678, 1200
PspPI	GGNCC	2 cut(s)	636, 676
PstNI	CAGNNNCTG	1 cut(s)	645
PsuI	RGATCY	2 cut(s)	940, 1198
RsaI	GTAC	4 cut(s)	312, 394, 1061, 1123
RsaNI	GTAC	4 cut(s)	311, 393, 1060, 1122
RseI	CAYNNNNRTG	1 cut(s)	541
SaqAI	TTAA	5 cut(s)	96, 276, 351, 510, 783
SatI	GCNGC	1 cut(s)	25
Sau3AI	GATC	8 cut(s)	331, 687, 739, 799, 940, 945, 1110, 1198
Sau96I	GGNCC	2 cut(s)	636, 676
SchI	GAGTC	6 cut(s)	97, 138, 306, 560, 887, 1062
SfaNI	GCATC	1 cut(s)	382
Sfr274I	CTCGAG	1 cut(s)	294
SinI	GGWCC	2 cut(s)	636, 676
SlaI	CTCGAG	1 cut(s)	294
SmiMI	CAYNNNNRTG	1 cut(s)	541
SmlI	CTYRAG	1 cut(s)	294
SmoI	CTYRAG	1 cut(s)	294
SnaBI	TACGTA	1 cut(s)	1063
Sse9I	AATT	8 cut(s)	98, 343, 423, 506, 555, 715, 773, 1174
SsiI	CCGC	2 cut(s)	25, 953
SspI	AATATT	1 cut(s)	972
SspMI	CTAG	5 cut(s)	129, 515, 720, 845, 1125
StyI	CCWWGG	1 cut(s)	1202
TaiI	ACGT	5 cut(s)	204, 238, 312, 1065, 1119
TaqI	TCGA	5 cut(s)	295, 379, 402, 980, 1071
TasI	AATT	8 cut(s)	98, 343, 423, 506, 555, 715, 773, 1174
TatI	WGTACW	1 cut(s)	392
TauI	GCSGC	1 cut(s)	27
TfiI	GAWTC	2 cut(s)	462, 591
Tru1I	TTAA	5 cut(s)	96, 276, 351, 510, 783
Tru9I	TTAA	5 cut(s)	96, 276, 351, 510, 783
TscAI	CASTG	2 cut(s)	25, 57
TspDTI	ATGAA	7 cut(s)	26, 99, 446, 673, 757, 771, 834
TspGWI	ACGGA	1 cut(s)	792
TspRI	CASTG	2 cut(s)	25, 57
Van91I	CCANNNNNTGG	1 cut(s)	645
VpaK11BI	GGWCC	2 cut(s)	636, 676
XapI	RAATTY	1 cut(s)	506
XceI	RCATGY	3 cut(s)	171, 486, 540
XhoI	CTCGAG	1 cut(s)	294
XmiI	GTMKAC	1 cut(s)	522
XspI	CTAG	5 cut(s)	129, 515, 720, 845, 1125

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.