Rroxscaffold_3G00228330

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
12703123 .. 12709338
6216 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00228330.1

Sequence Viewer

Length: 477 bp
ATGGATACGTGCACGAAGTGCATCAACCAAAAAAGTACTATCCTGCAAGATCAGTTGATTAACATTGACGTGGACTATAGGTACATGGTAGTGAGAATTCTCCCTTATGATGACACATTTGAAGATGATCTTTCCTACAAATTCAAGGTGGAGATCTTCTCTTTCGAGATTGGTGAATGGAGAGAGTCAAATATCTCATTCCCACGAAGATTTAAACTTAACGATATCAATTCCAATGTTCACTTTGCTCACAATGAAATGCTGTATTGGTCCAGTATCTGGGGCGATTATAACTTTCTGATTGGGTTGGACCCGTTCATAATCAGCGACACTAATAGCAACATCATCAGGACCAGTAGTACTAGCAATAGTAACTCCGGGGATACTCATCAATATTATTATAAATGTCGTTTCATTGAACTTATAGTTAAAGAAGGTTATGATGAGGATTTACGGTCATCCAATCAGAACAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

158

Amino Acids

18.78

Weight (kDa)

4.79

Isoelectric Point (pI)

42.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 291, 402
AccB7I CCANNNNNTGG 1 cut(s) 279
AcsI RAATTY 2 cut(s) 96, 140
AdeI CACNNNGTG 1 cut(s) 18
AfaI GTAC 3 cut(s) 37, 83, 361
AfiI CCNNNNNNNGG 1 cut(s) 279
AgsI TTSAA 3 cut(s) 122, 145, 419
AjiI CACGTC 1 cut(s) 70
Alw21I GWGCWC 1 cut(s) 14
Alw44I GTGCAC 1 cut(s) 10
AlwNI CAGNNNCTG 1 cut(s) 279
ApaLI GTGCAC 1 cut(s) 10
ApoI RAATTY 2 cut(s) 96, 140
AspS9I GGNCC 3 cut(s) 270, 310, 351
AsuC2I CCSGG 1 cut(s) 379
AsuHPI GGTGA 1 cut(s) 185
AvaII GGWCC 3 cut(s) 270, 310, 351
BaeGI GKGCMC 1 cut(s) 14
Bbv12I GWGCWC 1 cut(s) 14
BciVI GTATCC 1 cut(s) 376
BcnI CCSGG 1 cut(s) 379
BfaI CTAG 1 cut(s) 363
BfmI CTRYAG 1 cut(s) 76
BfuI GTATCC 1 cut(s) 376
BglII AGATCT 1 cut(s) 153
BmcAI AGTACT 2 cut(s) 37, 361
Bme1390I CCNGG 1 cut(s) 379
Bme18I GGWCC 3 cut(s) 270, 310, 351
BmgBI CACGTC 1 cut(s) 70
BmgT120I GGNCC 3 cut(s) 270, 310, 351
BmiI GGNNCC 1 cut(s) 312
BmrFI CCNGG 1 cut(s) 379
BmsI GCATC 1 cut(s) 30
BplI GAGNNNNNCTC 2 cut(s) 143, 175
BpuMI CCSGG 1 cut(s) 379
BsaAI YACGTR 1 cut(s) 9
BsaBI GATNNNNATC 1 cut(s) 387
BsaJI CCNNGG 1 cut(s) 378
Bsc4I CCNNNNNNNGG 1 cut(s) 279
Bse1I ACTGG 2 cut(s) 273, 354
Bse8I GATNNNNATC 1 cut(s) 387
BseDI CCNNGG 1 cut(s) 378
BseGI GGATG 1 cut(s) 458
BseJI GATNNNNATC 1 cut(s) 387
BseLI CCNNNNNNNGG 1 cut(s) 279
BseNI ACTGG 2 cut(s) 273, 354
BseSI GKGCMC 1 cut(s) 14
BsiHKAI GWGCWC 1 cut(s) 14
BsiSI CCGG 1 cut(s) 378
BslI CCNNNNNNNGG 1 cut(s) 279
Bsp1286I GDGCHC 1 cut(s) 14
Bsp143I GATC 3 cut(s) 49, 127, 153
BspLI GGNNCC 1 cut(s) 312
BsrI ACTGG 2 cut(s) 273, 354
BssECI CCNNGG 1 cut(s) 378
BssMI GATC 3 cut(s) 49, 127, 153
Bst4CI ACNGT 1 cut(s) 456
BstAPI GCANNNNNTGC 1 cut(s) 18
BstBAI YACGTR 1 cut(s) 9
BstF5I GGATG 1 cut(s) 458
BstKTI GATC 3 cut(s) 52, 130, 156
BstMBI GATC 3 cut(s) 49, 127, 153
BstMWI GCNNNNNNNGC 1 cut(s) 18
BstSCI CCNGG 1 cut(s) 377
BstSFI CTRYAG 1 cut(s) 76
BstSLI GKGCMC 1 cut(s) 14
BstX2I RGATCY 1 cut(s) 153
BstYI RGATCY 1 cut(s) 153
BsuI GTATCC 1 cut(s) 376
BtrI CACGTC 1 cut(s) 70
BtsCI GGATG 1 cut(s) 458
CaiI CAGNNNCTG 1 cut(s) 279
Cfr13I GGNCC 3 cut(s) 270, 310, 351
Csp6I GTAC 3 cut(s) 36, 82, 360
CviAII CATG 1 cut(s) 85
CviQI GTAC 3 cut(s) 36, 82, 360
DpnI GATC 3 cut(s) 51, 129, 155
DpnII GATC 3 cut(s) 49, 127, 153
DraI TTTAAA 1 cut(s) 214
DraIII CACNNNGTG 1 cut(s) 18
Eco32I GATATC 1 cut(s) 226
Eco47I GGWCC 3 cut(s) 270, 310, 351
EcoRI GAATTC 1 cut(s) 96
EcoRV GATATC 1 cut(s) 226
FaeI CATG 1 cut(s) 88
FaiI YATR 8 cut(s) 78, 86, 108, 291, 320, 402, 425, 441
FalI AAGNNNNNCTT 2 cut(s) 114, 146
FatI CATG 1 cut(s) 84
FokI GGATG 1 cut(s) 445
FspBI CTAG 1 cut(s) 363
HapII CCGG 1 cut(s) 378
Hin1II CATG 1 cut(s) 88
HinfI GANTC 1 cut(s) 185
HpaII CCGG 1 cut(s) 378
HphI GGTGA 1 cut(s) 185
Hpy166II GTNNAC 3 cut(s) 12, 73, 241
Hpy188I TCNGA 2 cut(s) 300, 468
Hpy188III TCNNGA 2 cut(s) 166, 349
Hpy8I GTNNAC 3 cut(s) 12, 73, 241
HpyAV CCTTC 1 cut(s) 428
HpyCH4III ACNGT 1 cut(s) 456
HpyCH4IV ACGT 2 cut(s) 8, 69
HpyCH4V TGCA 3 cut(s) 12, 21, 46
HpyF10VI GCNNNNNNNGC 1 cut(s) 18
HpySE526I ACGT 2 cut(s) 8, 69
Hsp92II CATG 1 cut(s) 88
Kzo9I GATC 3 cut(s) 49, 127, 153
LpnPI CCDG 6 cut(s) 56, 265, 286, 334, 367, 391
LweI GCATC 1 cut(s) 30
MaeI CTAG 1 cut(s) 363
MaeII ACGT 2 cut(s) 8, 69
MaeIII GTNAC 1 cut(s) 371
MalI GATC 3 cut(s) 51, 129, 155
MboI GATC 3 cut(s) 49, 127, 153
MboII GAAGA 3 cut(s) 134, 148, 219
MflI RGATCY 1 cut(s) 153
MhlI GDGCHC 1 cut(s) 14
MluCI AATT 3 cut(s) 96, 140, 229
MlyI GAGTC 1 cut(s) 194
MmeI TCCRAC 1 cut(s) 288
MnlI CCTC 1 cut(s) 439
MseI TTAA 4 cut(s) 60, 213, 219, 429
MslI CAYNNNNRTG 2 cut(s) 68, 89
MspI CCGG 1 cut(s) 378
MspR9I CCNGG 1 cut(s) 379
MwoI GCNNNNNNNGC 1 cut(s) 18
NciI CCSGG 1 cut(s) 379
NdeII GATC 3 cut(s) 49, 127, 153
NlaIII CATG 1 cut(s) 88
NlaIV GGNNCC 1 cut(s) 312
PflMI CCANNNNNTGG 1 cut(s) 279
PleI GAGTC 1 cut(s) 193
PpsI GAGTC 1 cut(s) 193
Ppu21I YACGTR 1 cut(s) 9
PsiI TTATAA 2 cut(s) 291, 402
PspN4I GGNNCC 1 cut(s) 312
PspPI GGNCC 3 cut(s) 270, 310, 351
PstNI CAGNNNCTG 1 cut(s) 279
PsuI RGATCY 1 cut(s) 153
RsaI GTAC 3 cut(s) 37, 83, 361
RsaNI GTAC 3 cut(s) 36, 82, 360
RseI CAYNNNNRTG 2 cut(s) 68, 89
SaqAI TTAA 4 cut(s) 60, 213, 219, 429
Sau3AI GATC 3 cut(s) 49, 127, 153
Sau96I GGNCC 3 cut(s) 270, 310, 351
ScaI AGTACT 2 cut(s) 37, 361
SchI GAGTC 1 cut(s) 194
ScrFI CCNGG 1 cut(s) 379
SduI GDGCHC 1 cut(s) 14
SetI ASST 5 cut(s) 11, 72, 83, 150, 439
SfaNI GCATC 1 cut(s) 30
SfcI CTRYAG 1 cut(s) 76
SinI GGWCC 3 cut(s) 270, 310, 351
SmiMI CAYNNNNRTG 2 cut(s) 68, 89
Sse9I AATT 3 cut(s) 96, 140, 229
SspI AATATT 1 cut(s) 395
SspMI CTAG 1 cut(s) 363
StyD4I CCNGG 1 cut(s) 377
TaaI ACNGT 1 cut(s) 456
TaiI ACGT 2 cut(s) 11, 72
TaqI TCGA 1 cut(s) 165
TasI AATT 3 cut(s) 96, 140, 229
TatI WGTACW 2 cut(s) 35, 359
Tru1I TTAA 4 cut(s) 60, 213, 219, 429
Tru9I TTAA 4 cut(s) 60, 213, 219, 429
TspDTI ATGAA 3 cut(s) 270, 307, 403
Van91I CCANNNNNTGG 1 cut(s) 279
VneI GTGCAC 1 cut(s) 10
VpaK11BI GGWCC 3 cut(s) 270, 310, 351
XapI RAATTY 2 cut(s) 96, 140
XspI CTAG 1 cut(s) 363
ZrmI AGTACT 2 cut(s) 37, 361
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.