Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001861.1

Orthogroup ID

OG0002373

Physical Location & Seq

Genomic Coordinates Reverse (-)

59734 .. 59979

Gene Structure 246 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001861.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 246 bp

ctgttgaggataattgttttcggcgatgatttatctcgaaaagtcgtcgttgatgagcaggtgcaagattccgacaacgttgagctgagcctggggctgtcgttgaacggtcggtttggggtggacccgaaggccaaggcgaggttgcaactcaaacgatcatcttcagtctcagacttctcgcctatagcgaggactcctgtgagagaggagcaggcaacgacgtgtcatgtaccccgactgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

EAR Jas NINJA_B

Protein Analysis

81

Amino Acids

8.98

Weight (kDa)

8.16

Isoelectric Point (pI)

49.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002373)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G29575 AT3G29575 AT3G29575
fragaria_vesca	FvH4_5g13760 FvH4_6g46820 FvH4_6g46820
malus_domestica	MD09G1067200.v1.1 MD17G1060200.v1.1
prunus_persica	Prupe.5G205900_v2.0.a1 Prupe.5G205900_v2.0.a1 Prupe.5G205900_v2.0.a1 Prupe.5G205900_v2.0.a1
pyrus_communis	pycom06g18020 pycom111g05650 pycom13g23090 pycom17g05990
rosa_chinensis	RchiOBHm_Chr2g0165801 RchiOBHm_Chr7g0183181
rosa_laevigata	RLG00000005069 RLG00000021557
rosa_multiflora	Rmu_co8279591.1_g000001 Rmu_co8332333.1_g000001 Rmu_sc0001861.1_g000014 Rmu_sc0003227.1_g000009 Rmu_sc0006832.1_g000002 Rmu_sc0012318.1_g000002 Rmu_ssc0000111.1_g000018
rosa_roxburghii	Rroxscaffold_2G00085490 Rroxscaffold_3G00270680
rosa_rugosa	Rorug02G0517800 Rorug06G0454600
rosa_samantha	Rh2AG583500 Rh2BG595600 Rh2CG221700 Rh2CG566300 Rh2DG605400 Rh7AG057000 Rh7BG056700 Rh7CG057800 Rh7DG056600
rosa_wichuraiana	Rw2G048660 Rw7G004650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	49
Acc36I	ACCTGC	1 cut(s)	49
AclI	AACGTT	1 cut(s)	78
AcuI	CTGAAG	1 cut(s)	150
AfaI	GTAC	1 cut(s)	234
AfiI	CCNNNNNNNGG	1 cut(s)	141
AflIII	ACRYGT	1 cut(s)	224
AgsI	TTSAA	1 cut(s)	106
AjiI	CACGTC	1 cut(s)	225
AjnI	CCWGG	1 cut(s)	90
AluBI	AGCT	1 cut(s)	85
AluI	AGCT	1 cut(s)	85
Alw26I	GTCTC	1 cut(s)	175
AoxI	GGCC	1 cut(s)	132
AspS9I	GGNCC	1 cut(s)	124
AvaII	GGWCC	1 cut(s)	124
BciT130I	CCWGG	1 cut(s)	92
BcoDI	GTCTC	1 cut(s)	175
BfmI	CTRYAG	1 cut(s)	186
BfuAI	ACCTGC	1 cut(s)	49
BlpI	GCTNAGC	1 cut(s)	86
Bme1390I	CCNGG	1 cut(s)	92
Bme18I	GGWCC	1 cut(s)	124
BmgBI	CACGTC	1 cut(s)	225
BmgT120I	GGNCC	1 cut(s)	124
BmiI	GGNNCC	1 cut(s)	126
BmrFI	CCNGG	1 cut(s)	92
Bpu1102I	GCTNAGC	1 cut(s)	86
BsaJI	CCNNGG	2 cut(s)	91, 135
Bsc4I	CCNNNNNNNGG	1 cut(s)	141
BseBI	CCWGG	1 cut(s)	92
BseDI	CCNNGG	2 cut(s)	91, 135
BseLI	CCNNNNNNNGG	1 cut(s)	141
BseMII	CTCAG	2 cut(s)	77, 186
BseRI	GAGGAG	1 cut(s)	224
Bsh1285I	CGRYCG	1 cut(s)	112
BshFI	GGCC	1 cut(s)	134
BsiEI	CGRYCG	1 cut(s)	112
BslI	CCNNNNNNNGG	1 cut(s)	141
BsmAI	GTCTC	1 cut(s)	175
BsnI	GGCC	1 cut(s)	134
Bsp143I	GATC	1 cut(s)	158
Bsp1720I	GCTNAGC	1 cut(s)	86
BspANI	GGCC	1 cut(s)	134
BspCNI	CTCAG	2 cut(s)	78, 185
BspLI	GGNNCC	1 cut(s)	126
BspMI	ACCTGC	1 cut(s)	49
BssECI	CCNNGG	2 cut(s)	91, 135
BssMI	GATC	1 cut(s)	158
BssT1I	CCWWGG	1 cut(s)	135
Bst2UI	CCWGG	1 cut(s)	92
Bst4CI	ACNGT	2 cut(s)	110, 243
BstC8I	GCNNGC	1 cut(s)	216
BstDEI	CTNAG	2 cut(s)	86, 172
BstKTI	GATC	1 cut(s)	161
BstMAI	GTCTC	1 cut(s)	175
BstMBI	GATC	1 cut(s)	158
BstMCI	CGRYCG	1 cut(s)	112
BstNI	CCWGG	1 cut(s)	92
BstSCI	CCNGG	1 cut(s)	90
BstSFI	CTRYAG	1 cut(s)	186
BsuRI	GGCC	1 cut(s)	134
BtgZI	GCGATG	1 cut(s)	39
BtrI	CACGTC	1 cut(s)	225
BveI	ACCTGC	1 cut(s)	49
Cac8I	GCNNGC	1 cut(s)	216
Cfr13I	GGNCC	1 cut(s)	124
Csp6I	GTAC	1 cut(s)	233
CviAII	CATG	1 cut(s)	230
CviJI	RGCY	4 cut(s)	85, 90, 97, 134
CviKI_1	RGCY	4 cut(s)	85, 90, 97, 134
CviQI	GTAC	1 cut(s)	233
DdeI	CTNAG	2 cut(s)	86, 172
DpnI	GATC	1 cut(s)	160
DpnII	GATC	1 cut(s)	158
Eco130I	CCWWGG	1 cut(s)	135
Eco47I	GGWCC	1 cut(s)	124
Eco57I	CTGAAG	1 cut(s)	150
EcoRII	CCWGG	1 cut(s)	90
EcoT14I	CCWWGG	1 cut(s)	135
ErhI	CCWWGG	1 cut(s)	135
FaeI	CATG	1 cut(s)	233
FaiI	YATR	2 cut(s)	188, 231
FatI	CATG	1 cut(s)	229
HaeIII	GGCC	1 cut(s)	134
Hin1II	CATG	1 cut(s)	233
HinfI	GANTC	2 cut(s)	68, 196
Hpy166II	GTNNAC	1 cut(s)	124
Hpy188I	TCNGA	2 cut(s)	73, 175
Hpy188III	TCNNGA	1 cut(s)	36
Hpy8I	GTNNAC	1 cut(s)	124
Hpy99I	CGWCG	2 cut(s)	50, 226
HpyAV	CCTTC	1 cut(s)	124
HpyCH4III	ACNGT	2 cut(s)	110, 243
HpyCH4IV	ACGT	2 cut(s)	78, 224
HpyCH4V	TGCA	2 cut(s)	64, 148
HpyF3I	CTNAG	2 cut(s)	86, 172
HpySE526I	ACGT	2 cut(s)	78, 224
Hsp92II	CATG	1 cut(s)	233
Kzo9I	GATC	1 cut(s)	158
LmnI	GCTCC	1 cut(s)	211
LpnPI	CCDG	5 cut(s)	44, 77, 104, 200, 213
MaeII	ACGT	2 cut(s)	78, 224
MalI	GATC	1 cut(s)	160
MboI	GATC	1 cut(s)	158
MboII	GAAGA	1 cut(s)	156
MluCI	AATT	1 cut(s)	12
MlyI	GAGTC	1 cut(s)	190
MmeI	TCCRAC	1 cut(s)	96
MnlI	CCTC	3 cut(s)	135, 186, 202
MspR9I	CCNGG	1 cut(s)	92
MvaI	CCWGG	1 cut(s)	92
NdeII	GATC	1 cut(s)	158
NlaIII	CATG	1 cut(s)	233
NlaIV	GGNNCC	1 cut(s)	126
PaqCI	CACCTGC	1 cut(s)	49
PcsI	WCGNNNNNNNCGW	1 cut(s)	188
PfeI	GAWTC	1 cut(s)	68
PleI	GAGTC	1 cut(s)	190
PpsI	GAGTC	1 cut(s)	190
Psp1406I	AACGTT	1 cut(s)	78
Psp6I	CCWGG	1 cut(s)	90
PspGI	CCWGG	1 cut(s)	90
PspN4I	GGNNCC	1 cut(s)	126
PspPI	GGNCC	1 cut(s)	124
RsaI	GTAC	1 cut(s)	234
RsaNI	GTAC	1 cut(s)	233
Sau3AI	GATC	1 cut(s)	158
Sau96I	GGNCC	1 cut(s)	124
SchI	GAGTC	1 cut(s)	190
ScrFI	CCNGG	1 cut(s)	92
SetI	ASST	5 cut(s)	63, 81, 87, 146, 227
SfcI	CTRYAG	1 cut(s)	186
SinI	GGWCC	1 cut(s)	124
Sse9I	AATT	1 cut(s)	12
StyD4I	CCNGG	1 cut(s)	90
StyI	CCWWGG	1 cut(s)	135
TaaI	ACNGT	2 cut(s)	110, 243
TaiI	ACGT	2 cut(s)	81, 227
TaqI	TCGA	1 cut(s)	37
TasI	AATT	1 cut(s)	12
TfiI	GAWTC	1 cut(s)	68
VpaK11BI	GGWCC	1 cut(s)	124

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.