Rmu_sc0002126.1_g000022

ATP-dependent zinc metalloprotease FTSH

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002126.1
Physical Location & Seq
Forward (+)
109584 .. 109913
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002126.1_g000022.1.cds

Sequence Viewer

Length: 330 bp
atgtttgtgggcgttggagctgcgagagtgaggaagctttttaatgctgcaaaagagaaatctcccagcattatacttattgacgaaatagatgctgttgggggacaacgaagatccgatggctatagggatacagtgaaccagttgctagtcgaactagatggcttcaaacaaaatgatggagtaattgtgataggtgcgactaactttccggaattattggataaagctctagtgagagctggacgatttgaccgtcaagtttttatccatatgccagatgttaaaggacggagggagatattggaatcatacatgtcgaaagtgtag

Protein Analysis

109

Amino Acids

12.18

Weight (kDa)

9.1

Isoelectric Point (pI)

43.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 211
AclWI GGATC 1 cut(s) 108
AflIII ACRYGT 1 cut(s) 315
AgsI TTSAA 1 cut(s) 169
AluBI AGCT 4 cut(s) 20, 37, 230, 242
AluI AGCT 4 cut(s) 20, 37, 230, 242
AlwI GGATC 1 cut(s) 108
Aor13HI TCCGGA 1 cut(s) 211
ApeKI GCWGC 2 cut(s) 20, 47
BbvI GCAGC 2 cut(s) 7, 34
BccI CCATC 3 cut(s) 113, 155, 173
BcgI CGANNNNNNTGC 2 cut(s) 74, 108
BciVI GTATCC 1 cut(s) 124
BfaI CTAG 3 cut(s) 149, 158, 233
BfmI CTRYAG 1 cut(s) 124
BfuI GTATCC 1 cut(s) 124
BisI GCNGC 2 cut(s) 21, 48
BlsI GCNGC 2 cut(s) 22, 49
BmsI GCATC 1 cut(s) 82
BsaWI WCCGGW 1 cut(s) 211
BsaXI ACNNNNNCTCC 2 cut(s) 174, 204
Bse1I ACTGG 1 cut(s) 142
BseAI TCCGGA 1 cut(s) 211
BseNI ACTGG 1 cut(s) 142
BseXI GCAGC 2 cut(s) 7, 34
BseYI CCCAGC 1 cut(s) 65
BsiSI CCGG 1 cut(s) 212
BslFI GGGAC 1 cut(s) 117
BsmFI GGGAC 1 cut(s) 117
Bsp13I TCCGGA 1 cut(s) 211
Bsp143I GATC 1 cut(s) 113
BspEI TCCGGA 1 cut(s) 211
BspPI GGATC 1 cut(s) 108
BsrI ACTGG 1 cut(s) 142
BssMI GATC 1 cut(s) 113
Bst4CI ACNGT 2 cut(s) 136, 257
BstKTI GATC 1 cut(s) 116
BstMBI GATC 1 cut(s) 113
BstNSI RCATGY 1 cut(s) 319
BstSFI CTRYAG 1 cut(s) 124
BstV1I GCAGC 2 cut(s) 7, 34
BstX2I RGATCY 1 cut(s) 113
BstYI RGATCY 1 cut(s) 113
BsuI GTATCC 1 cut(s) 124
BtsIMutI CAGTG 1 cut(s) 141
CviAII CATG 1 cut(s) 316
CviJI RGCY 6 cut(s) 20, 37, 123, 165, 230, 242
CviKI_1 RGCY 6 cut(s) 20, 37, 123, 165, 230, 242
DpnI GATC 1 cut(s) 115
DpnII GATC 1 cut(s) 113
FaeI CATG 1 cut(s) 319
FaiI YATR 6 cut(s) 74, 126, 273, 275, 313, 317
FaqI GGGAC 1 cut(s) 117
FatI CATG 1 cut(s) 315
FauNDI CATATG 1 cut(s) 273
Fnu4HI GCNGC 2 cut(s) 21, 48
Fsp4HI GCNGC 2 cut(s) 21, 48
FspBI CTAG 3 cut(s) 149, 158, 233
GluI GCNGC 2 cut(s) 21, 48
GsaI CCCAGC 1 cut(s) 69
HapII CCGG 1 cut(s) 212
Hin1II CATG 1 cut(s) 319
HindIII AAGCTT 1 cut(s) 35
HinfI GANTC 1 cut(s) 308
HpaII CCGG 1 cut(s) 212
Hpy166II GTNNAC 1 cut(s) 139
Hpy188I TCNGA 1 cut(s) 118
Hpy188III TCNNGA 1 cut(s) 212
Hpy8I GTNNAC 1 cut(s) 139
HpyCH4III ACNGT 2 cut(s) 136, 257
HpyCH4V TGCA 1 cut(s) 50
Hsp92II CATG 1 cut(s) 319
Kpn2I TCCGGA 1 cut(s) 211
Kzo9I GATC 1 cut(s) 113
LmnI GCTCC 1 cut(s) 17
LpnPI CCDG 5 cut(s) 79, 155, 225, 228, 291
Lsp1109I GCAGC 2 cut(s) 7, 34
LweI GCATC 1 cut(s) 82
MaeI CTAG 3 cut(s) 149, 158, 233
MalI GATC 1 cut(s) 115
MboI GATC 1 cut(s) 113
MboII GAAGA 1 cut(s) 123
MflI RGATCY 1 cut(s) 113
MluCI AATT 2 cut(s) 186, 215
MnlI CCTC 2 cut(s) 24, 288
MroI TCCGGA 1 cut(s) 211
MseI TTAA 2 cut(s) 42, 285
MspI CCGG 1 cut(s) 212
NdeI CATATG 1 cut(s) 273
NdeII GATC 1 cut(s) 113
NlaIII CATG 1 cut(s) 319
NspI RCATGY 1 cut(s) 319
PciI ACATGT 1 cut(s) 315
PcsI WCGNNNNNNNCGW 1 cut(s) 253
PfeI GAWTC 1 cut(s) 308
PkrI GCNGC 2 cut(s) 22, 49
PscI ACATGT 1 cut(s) 315
PspFI CCCAGC 1 cut(s) 65
PsuI RGATCY 1 cut(s) 113
SaqAI TTAA 2 cut(s) 42, 285
SatI GCNGC 2 cut(s) 21, 48
Sau3AI GATC 1 cut(s) 113
SetI ASST 5 cut(s) 22, 39, 199, 232, 244
SfaNI GCATC 1 cut(s) 82
SfcI CTRYAG 1 cut(s) 124
Sse9I AATT 2 cut(s) 186, 215
SspMI CTAG 3 cut(s) 149, 158, 233
TaaI ACNGT 2 cut(s) 136, 257
TaqI TCGA 2 cut(s) 153, 320
TasI AATT 2 cut(s) 186, 215
TfiI GAWTC 1 cut(s) 308
Tru1I TTAA 2 cut(s) 42, 285
Tru9I TTAA 2 cut(s) 42, 285
TscAI CASTG 1 cut(s) 141
TseI GCWGC 2 cut(s) 20, 47
TspGWI ACGGA 1 cut(s) 307
TspRI CASTG 1 cut(s) 141
XceI RCATGY 1 cut(s) 319
XspI CTAG 3 cut(s) 149, 158, 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.