Rh2CG087200

ATP-dependent zinc metalloprotease FTSH

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
7193727 .. 7194179
453 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG087200.1

Sequence Viewer

Length: 453 bp
ATGTTTGTGGGTGTTGGAGCTGCGAGAGTGAGGAAGCTTTTTAATGCTGCAAAAGAGAAATCTCCCAGCATTATATTTATTGACGAAATAGATGCTGTTGGGGGACAACGAAGATCCGATGGCTATAGGGATACAGTGAACCAGTTGCTAGTCGAACTAGATGGCTTCAAACAAAATGATGGAGTAATTGTGATAGGTGCGACTAACTTTCTGGAATTATTGGATAAAGCTCTAGTGAGAGCTGGACGATTTGACCGTCAAATTTTTATCCATATGCCAGATGTTAAAGGACTGAGGGAGATATTGGAATCATACATGTCAAAAGTTGTTGCGGCAGATGGTGTAAACCTGGGTGCTAGAGGAACGAAGGAGTTTTCAACTGCTGATCTTGCAAACTTGGTCAACATTGCAGCCGTGAAAGCAGCAGTTGATGGTTCTAAACAAGTGAAGTGA

Protein Analysis

150

Amino Acids

16.25

Weight (kDa)

8.92

Isoelectric Point (pI)

28.16

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AAA PF00004 2 - 91 1.6e-26 ATPase family associated with various cellular activities (AAA)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 332
AclWI GGATC 1 cut(s) 108
AcsI RAATTY 1 cut(s) 261
AflIII ACRYGT 1 cut(s) 315
AgsI TTSAA 2 cut(s) 169, 378
AjnI CCWGG 1 cut(s) 348
AluBI AGCT 4 cut(s) 20, 37, 230, 242
AluI AGCT 4 cut(s) 20, 37, 230, 242
AlwI GGATC 1 cut(s) 108
ApeKI GCWGC 4 cut(s) 20, 47, 410, 422
ApoI RAATTY 1 cut(s) 261
BbvI GCAGC 4 cut(s) 7, 34, 422, 434
BccI CCATC 5 cut(s) 113, 155, 173, 332, 425
BceAI ACGGC 1 cut(s) 398
BcgI CGANNNNNNTGC 2 cut(s) 74, 108
BciT130I CCWGG 1 cut(s) 350
BciVI GTATCC 1 cut(s) 124
BfaI CTAG 4 cut(s) 149, 158, 233, 357
BfmI CTRYAG 1 cut(s) 124
BfuI GTATCC 1 cut(s) 124
BisI GCNGC 5 cut(s) 21, 48, 333, 411, 423
BlsI GCNGC 5 cut(s) 22, 49, 334, 412, 424
Bme1390I CCNGG 1 cut(s) 350
BmrFI CCNGG 1 cut(s) 350
BmsI GCATC 1 cut(s) 82
BsaJI CCNNGG 1 cut(s) 349
BsaXI ACNNNNNCTCC 2 cut(s) 174, 204
Bse1I ACTGG 1 cut(s) 142
Bse3DI GCAATG 1 cut(s) 405
BseBI CCWGG 1 cut(s) 350
BseDI CCNNGG 1 cut(s) 349
BseMI GCAATG 1 cut(s) 405
BseMII CTCAG 1 cut(s) 284
BseNI ACTGG 1 cut(s) 142
BseXI GCAGC 4 cut(s) 7, 34, 422, 434
BseYI CCCAGC 1 cut(s) 65
BslFI GGGAC 1 cut(s) 117
BsmFI GGGAC 1 cut(s) 117
Bsp143I GATC 2 cut(s) 113, 385
BspACI CCGC 1 cut(s) 332
BspCNI CTCAG 1 cut(s) 285
BspPI GGATC 1 cut(s) 108
BsrDI GCAATG 1 cut(s) 405
BsrI ACTGG 1 cut(s) 142
BssECI CCNNGG 1 cut(s) 349
BssMI GATC 2 cut(s) 113, 385
Bst2UI CCWGG 1 cut(s) 350
Bst4CI ACNGT 2 cut(s) 136, 257
BstDEI CTNAG 1 cut(s) 293
BstKTI GATC 2 cut(s) 116, 388
BstMBI GATC 2 cut(s) 113, 385
BstMWI GCNNNNNNNGC 2 cut(s) 389, 419
BstNI CCWGG 1 cut(s) 350
BstNSI RCATGY 1 cut(s) 319
BstSCI CCNGG 1 cut(s) 348
BstSFI CTRYAG 1 cut(s) 124
BstV1I GCAGC 4 cut(s) 7, 34, 422, 434
BstX2I RGATCY 1 cut(s) 113
BstYI RGATCY 1 cut(s) 113
BsuI GTATCC 1 cut(s) 124
BtsIMutI CAGTG 1 cut(s) 141
CviAII CATG 1 cut(s) 316
CviJI RGCY 7 cut(s) 20, 37, 123, 165, 230, 242, 413
CviKI_1 RGCY 7 cut(s) 20, 37, 123, 165, 230, 242, 413
DdeI CTNAG 1 cut(s) 293
DpnI GATC 2 cut(s) 115, 387
DpnII GATC 2 cut(s) 113, 385
EcoRII CCWGG 1 cut(s) 348
FaeI CATG 1 cut(s) 319
FaiI YATR 6 cut(s) 74, 126, 273, 275, 313, 317
FaqI GGGAC 1 cut(s) 117
FatI CATG 1 cut(s) 315
FauNDI CATATG 1 cut(s) 273
Fnu4HI GCNGC 5 cut(s) 21, 48, 333, 411, 423
Fsp4HI GCNGC 5 cut(s) 21, 48, 333, 411, 423
FspBI CTAG 4 cut(s) 149, 158, 233, 357
GluI GCNGC 5 cut(s) 21, 48, 333, 411, 423
GsaI CCCAGC 1 cut(s) 69
Hin1II CATG 1 cut(s) 319
HincII GTYRAC 1 cut(s) 403
HindII GTYRAC 1 cut(s) 403
HindIII AAGCTT 1 cut(s) 35
HinfI GANTC 1 cut(s) 308
Hpy166II GTNNAC 3 cut(s) 139, 346, 403
Hpy188I TCNGA 1 cut(s) 118
Hpy188III TCNNGA 1 cut(s) 212
Hpy8I GTNNAC 3 cut(s) 139, 346, 403
HpyAV CCTTC 1 cut(s) 361
HpyCH4III ACNGT 2 cut(s) 136, 257
HpyCH4V TGCA 3 cut(s) 50, 392, 410
HpyF10VI GCNNNNNNNGC 2 cut(s) 389, 419
HpyF3I CTNAG 1 cut(s) 293
Hsp92II CATG 1 cut(s) 319
Kzo9I GATC 2 cut(s) 113, 385
LmnI GCTCC 1 cut(s) 17
LpnPI CCDG 7 cut(s) 79, 155, 197, 228, 291, 335, 362
Lsp1109I GCAGC 4 cut(s) 7, 34, 422, 434
LweI GCATC 1 cut(s) 82
MaeI CTAG 4 cut(s) 149, 158, 233, 357
MalI GATC 2 cut(s) 115, 387
MboI GATC 2 cut(s) 113, 385
MboII GAAGA 1 cut(s) 123
MflI RGATCY 1 cut(s) 113
MluCI AATT 3 cut(s) 186, 215, 261
MnlI CCTC 3 cut(s) 24, 288, 353
MseI TTAA 2 cut(s) 42, 285
MspR9I CCNGG 1 cut(s) 350
MvaI CCWGG 1 cut(s) 350
MwoI GCNNNNNNNGC 2 cut(s) 389, 419
NdeI CATATG 1 cut(s) 273
NdeII GATC 2 cut(s) 113, 385
NlaIII CATG 1 cut(s) 319
NspI RCATGY 1 cut(s) 319
PciI ACATGT 1 cut(s) 315
PcsI WCGNNNNNNNCGW 1 cut(s) 253
PfeI GAWTC 1 cut(s) 308
PkrI GCNGC 5 cut(s) 22, 49, 334, 412, 424
PscI ACATGT 1 cut(s) 315
Psp6I CCWGG 1 cut(s) 348
PspFI CCCAGC 1 cut(s) 65
PspGI CCWGG 1 cut(s) 348
PsuI RGATCY 1 cut(s) 113
SaqAI TTAA 2 cut(s) 42, 285
SatI GCNGC 5 cut(s) 21, 48, 333, 411, 423
Sau3AI GATC 2 cut(s) 113, 385
ScrFI CCNGG 1 cut(s) 350
SetI ASST 6 cut(s) 22, 39, 199, 232, 244, 351
SfaNI GCATC 1 cut(s) 82
SfcI CTRYAG 1 cut(s) 124
Sse9I AATT 3 cut(s) 186, 215, 261
SsiI CCGC 1 cut(s) 332
SspMI CTAG 4 cut(s) 149, 158, 233, 357
StyD4I CCNGG 1 cut(s) 348
TaaI ACNGT 2 cut(s) 136, 257
TaqI TCGA 1 cut(s) 153
TasI AATT 3 cut(s) 186, 215, 261
TauI GCSGC 1 cut(s) 335
TfiI GAWTC 1 cut(s) 308
Tru1I TTAA 2 cut(s) 42, 285
Tru9I TTAA 2 cut(s) 42, 285
TscAI CASTG 1 cut(s) 141
TseI GCWGC 4 cut(s) 20, 47, 410, 422
TspRI CASTG 1 cut(s) 141
XapI RAATTY 1 cut(s) 261
XceI RCATGY 1 cut(s) 319
XspI CTAG 4 cut(s) 149, 158, 233, 357
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.