Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003822.1

Orthogroup ID

OG0006967

Physical Location & Seq

Genomic Coordinates Reverse (-)

102759 .. 103082

Gene Structure 324 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003822.1_g000025.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 324 bp

atggactatttggcccaacaaacgggggcagaagcccaacgtcaagcagttcgcgactccgtcgacgagattcgtgttgctcatgagcgtatacgttctgagaacgctgagattcaagctcaaaatgctgaatttctatctcagttgctcaacgaacttctagctcttcgggttacctcagtgactcattcttcaccggctccggtgtctcctaacccactgcaatttggctctttcccatttgctgaaccatctaattcgacggtttcggctcctccacctgtttaccctccaaggactgggtattttgagcttcactcctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

107

Amino Acids

11.78

Weight (kDa)

5.0

Isoelectric Point (pI)

54.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006967)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0451501 RchiOBHm_Chr3g0478591 RchiOBHm_Chr4g0415941 RchiOBHm_Chr5g0018841
rosa_laevigata	RLG00000004493 RLG00000013536
rosa_multiflora	Rmu_sc0000200.1_g000014 Rmu_sc0001488.1_g000024 Rmu_sc0002934.1_g000046 Rmu_sc0003822.1_g000025 Rmu_sc0004094.1_g000027 Rmu_sc0012521.1_g000009 Rmu_sc0031157.1_g000001
rosa_roxburghii	Rroxscaffold_1G00018770 Rroxscaffold_2G00080230 Rroxscaffold_2G00093080 Rroxscaffold_2G00108020 Rroxscaffold_2G00131900 Rroxscaffold_7G00190550 Rroxscaffold_7G00192620 Rroxscaffold_7G00194150 Rroxscaffold_7G00214830
rosa_rugosa	Rorug07G0096500
rosa_samantha	Rh4CG435100 Rh7AG275300 Rh7CG294100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	299
AccI	GTMKAC	2 cut(s)	63, 91
AccII	CGCG	1 cut(s)	54
AcsI	RAATTY	1 cut(s)	131
AfiI	CCNNNNNNNGG	2 cut(s)	22, 299
AgsI	TTSAA	1 cut(s)	116
AluBI	AGCT	3 cut(s)	119, 164, 313
AluI	AGCT	3 cut(s)	119, 164, 313
Alw26I	GTCTC	1 cut(s)	213
AoxI	GGCC	1 cut(s)	12
ApoI	RAATTY	1 cut(s)	131
AspS9I	GGNCC	1 cut(s)	13
AsuHPI	GGTGA	1 cut(s)	186
BccI	CCATC	1 cut(s)	259
BcoDI	GTCTC	1 cut(s)	213
BfaI	CTAG	1 cut(s)	161
BmgT120I	GGNCC	1 cut(s)	13
BmiI	GGNNCC	2 cut(s)	201, 273
BmrI	ACTGGG	1 cut(s)	309
BmuI	ACTGGG	1 cut(s)	309
BplI	GAGNNNNNCTC	1 cut(s)	302
BsaJI	CCNNGG	1 cut(s)	293
BsaWI	WCCGGW	1 cut(s)	202
Bsc4I	CCNNNNNNNGG	2 cut(s)	22, 299
Bse118I	RCCGGY	1 cut(s)	196
Bse1I	ACTGG	1 cut(s)	304
BseDI	CCNNGG	1 cut(s)	293
BseLI	CCNNNNNNNGG	2 cut(s)	22, 299
BseMII	CTCAG	4 cut(s)	90, 99, 155, 192
BseNI	ACTGG	1 cut(s)	304
BseRI	GAGGAG	1 cut(s)	264
Bsh1236I	CGCG	1 cut(s)	54
BshFI	GGCC	1 cut(s)	14
BsiSI	CCGG	2 cut(s)	197, 203
BslI	CCNNNNNNNGG	2 cut(s)	22, 299
BsmAI	GTCTC	1 cut(s)	213
BsnI	GGCC	1 cut(s)	14
Bsp68I	TCGCGA	1 cut(s)	54
BspANI	GGCC	1 cut(s)	14
BspCNI	CTCAG	4 cut(s)	91, 100, 154, 191
BspFNI	CGCG	1 cut(s)	54
BspHI	TCATGA	1 cut(s)	82
BspLI	GGNNCC	2 cut(s)	201, 273
BspQI	GCTCTTC	1 cut(s)	171
BsrFI	RCCGGY	1 cut(s)	196
BsrI	ACTGG	1 cut(s)	304
BssAI	RCCGGY	1 cut(s)	196
BssECI	CCNNGG	1 cut(s)	293
BssNAI	GTATAC	1 cut(s)	92
BssT1I	CCWWGG	1 cut(s)	293
Bst1107I	GTATAC	1 cut(s)	92
Bst4CI	ACNGT	1 cut(s)	265
Bst6I	CTCTTC	1 cut(s)	171
BstDEI	CTNAG	4 cut(s)	99, 108, 141, 178
BstEII	GGTNACC	1 cut(s)	172
BstFNI	CGCG	1 cut(s)	54
BstMAI	GTCTC	1 cut(s)	213
BstMWI	GCNNNNNNNGC	1 cut(s)	125
BstPI	GGTNACC	1 cut(s)	172
BstUI	CGCG	1 cut(s)	54
BstZ17I	GTATAC	1 cut(s)	92
BsuRI	GGCC	1 cut(s)	14
BtsI	GCAGTG	1 cut(s)	218
BtsIMutI	CAGTG	2 cut(s)	186, 218
BtuMI	TCGCGA	1 cut(s)	54
CciI	TCATGA	1 cut(s)	82
Cfr10I	RCCGGY	1 cut(s)	196
Cfr13I	GGNCC	1 cut(s)	13
CviAII	CATG	1 cut(s)	83
CviJI	RGCY	8 cut(s)	14, 35, 119, 164, 200, 231, 272, 313
CviKI_1	RGCY	8 cut(s)	14, 35, 119, 164, 200, 231, 272, 313
DdeI	CTNAG	4 cut(s)	99, 108, 141, 178
Eam1104I	CTCTTC	1 cut(s)	171
EarI	CTCTTC	1 cut(s)	171
Eco130I	CCWWGG	1 cut(s)	293
Eco91I	GGTNACC	1 cut(s)	172
EcoO65I	GGTNACC	1 cut(s)	172
EcoT14I	CCWWGG	1 cut(s)	293
ErhI	CCWWGG	1 cut(s)	293
FaeI	CATG	1 cut(s)	86
FaiI	YATR	2 cut(s)	84, 92
FatI	CATG	1 cut(s)	82
FblI	GTMKAC	2 cut(s)	63, 91
FspBI	CTAG	1 cut(s)	161
HaeIII	GGCC	1 cut(s)	14
HapII	CCGG	2 cut(s)	197, 203
Hin1II	CATG	1 cut(s)	86
HincII	GTYRAC	1 cut(s)	64
HindII	GTYRAC	1 cut(s)	64
HinfI	GANTC	4 cut(s)	56, 70, 112, 184
HpaII	CCGG	2 cut(s)	197, 203
HphI	GGTGA	1 cut(s)	186
Hpy166II	GTNNAC	3 cut(s)	64, 92, 286
Hpy188I	TCNGA	1 cut(s)	100
Hpy188III	TCNNGA	3 cut(s)	53, 83, 321
Hpy8I	GTNNAC	3 cut(s)	64, 92, 286
Hpy99I	CGWCG	3 cut(s)	65, 68, 265
HpyCH4III	ACNGT	1 cut(s)	265
HpyCH4IV	ACGT	2 cut(s)	40, 94
HpyCH4V	TGCA	1 cut(s)	223
HpyF10VI	GCNNNNNNNGC	1 cut(s)	125
HpyF3I	CTNAG	4 cut(s)	99, 108, 141, 178
HpySE526I	ACGT	2 cut(s)	40, 94
Hsp92II	CATG	1 cut(s)	86
LguI	GCTCTTC	1 cut(s)	171
LmnI	GCTCC	2 cut(s)	205, 277
LpnPI	CCDG	4 cut(s)	210, 216, 285, 294
MaeI	CTAG	1 cut(s)	161
MaeII	ACGT	2 cut(s)	40, 94
MaeIII	GTNAC	2 cut(s)	172, 181
MboII	GAAGA	2 cut(s)	158, 183
MluCI	AATT	3 cut(s)	131, 224, 256
MlyI	GAGTC	2 cut(s)	50, 178
MnlI	CCTC	3 cut(s)	187, 285, 300
MspI	CCGG	2 cut(s)	197, 203
MvnI	CGCG	1 cut(s)	54
MwoI	GCNNNNNNNGC	1 cut(s)	125
NlaIII	CATG	1 cut(s)	86
NlaIV	GGNNCC	2 cut(s)	201, 273
NmuCI	GTSAC	1 cut(s)	181
NruI	TCGCGA	1 cut(s)	54
PagI	TCATGA	1 cut(s)	82
PciSI	GCTCTTC	1 cut(s)	171
PfeI	GAWTC	2 cut(s)	70, 112
PflFI	GACNNNGTC	1 cut(s)	59
PflMI	CCANNNNNTGG	1 cut(s)	299
PleI	GAGTC	2 cut(s)	50, 178
PpsI	GAGTC	2 cut(s)	50, 178
PspEI	GGTNACC	1 cut(s)	172
PspN4I	GGNNCC	2 cut(s)	201, 273
PspPI	GGNCC	1 cut(s)	13
PsyI	GACNNNGTC	1 cut(s)	59
RruI	TCGCGA	1 cut(s)	54
SalI	GTCGAC	1 cut(s)	62
SapI	GCTCTTC	1 cut(s)	171
Sau96I	GGNCC	1 cut(s)	13
SchI	GAGTC	2 cut(s)	50, 178
SetI	ASST	7 cut(s)	43, 97, 121, 166, 179, 283, 315
SgrDI	CGTCGACG	1 cut(s)	62
Sse9I	AATT	3 cut(s)	131, 224, 256
SspMI	CTAG	1 cut(s)	161
StyI	CCWWGG	1 cut(s)	293
TaaI	ACNGT	1 cut(s)	265
TaiI	ACGT	2 cut(s)	43, 97
TaqI	TCGA	2 cut(s)	63, 260
TasI	AATT	3 cut(s)	131, 224, 256
TfiI	GAWTC	2 cut(s)	70, 112
TscAI	CASTG	2 cut(s)	186, 225
TseFI	GTSAC	1 cut(s)	181
Tsp45I	GTSAC	1 cut(s)	181
TspGWI	ACGGA	1 cut(s)	49
TspRI	CASTG	2 cut(s)	186, 225
Tth111I	GACNNNGTC	1 cut(s)	59
Van91I	CCANNNNNTGG	1 cut(s)	299
XapI	RAATTY	1 cut(s)	131
XmiI	GTMKAC	2 cut(s)	63, 91
XspI	CTAG	1 cut(s)	161

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.