Rroxscaffold_1G00018770

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
22903808 .. 22904662
855 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00018770.1

Sequence Viewer

Length: 168 bp
ATGACTCTAAGAGGACCCAGAGATGGTGGAGGAGTGATAGAGGCAGCCGGAAATGTGAATGGCGGAGCTGCCTTCCGGGAAGGCTGGTCTAGTCCGGCTAGTGTGAGGAAGATGGATCTTGCCAGTGGGCTTGGGCCTCTACCTTGCTGCGTTGTGGTTGCAGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

5.43

Weight (kDa)

7.82

Isoelectric Point (pI)

42.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 63
AclWI GGATC 1 cut(s) 123
AfiI CCNNNNNNNGG 1 cut(s) 23
AluBI AGCT 2 cut(s) 68, 164
AluI AGCT 2 cut(s) 68, 164
AlwI GGATC 1 cut(s) 123
AoxI GGCC 1 cut(s) 134
ApeKI GCWGC 4 cut(s) 44, 68, 147, 161
AspS9I GGNCC 2 cut(s) 14, 134
AsuC2I CCSGG 1 cut(s) 77
AvaII GGWCC 1 cut(s) 14
BbvI GCAGC 3 cut(s) 55, 56, 134
BccI CCATC 2 cut(s) 17, 106
BcnI CCSGG 1 cut(s) 77
BfaI CTAG 2 cut(s) 90, 99
BisI GCNGC 4 cut(s) 45, 69, 148, 162
BlsI GCNGC 4 cut(s) 46, 70, 149, 163
Bme1390I CCNGG 1 cut(s) 77
Bme18I GGWCC 1 cut(s) 14
BmgT120I GGNCC 2 cut(s) 14, 134
BmiI GGNNCC 1 cut(s) 16
BmrFI CCNGG 1 cut(s) 77
BpuMI CCSGG 1 cut(s) 77
Bsc4I CCNNNNNNNGG 1 cut(s) 23
Bse1I ACTGG 1 cut(s) 123
BseLI CCNNNNNNNGG 1 cut(s) 23
BseNI ACTGG 1 cut(s) 123
BseRI GAGGAG 1 cut(s) 45
BseXI GCAGC 3 cut(s) 55, 56, 134
BshFI GGCC 1 cut(s) 136
BsiSI CCGG 3 cut(s) 48, 76, 95
BslI CCNNNNNNNGG 1 cut(s) 23
BsnI GGCC 1 cut(s) 136
Bsp143I GATC 1 cut(s) 115
BspACI CCGC 1 cut(s) 63
BspANI GGCC 1 cut(s) 136
BspLI GGNNCC 1 cut(s) 16
BspPI GGATC 1 cut(s) 123
BsrI ACTGG 1 cut(s) 123
BssMI GATC 1 cut(s) 115
BstDEI CTNAG 2 cut(s) 8, 165
BstKTI GATC 1 cut(s) 118
BstMBI GATC 1 cut(s) 115
BstSCI CCNGG 1 cut(s) 75
BstV1I GCAGC 3 cut(s) 55, 56, 134
BstX2I RGATCY 1 cut(s) 115
BstYI RGATCY 1 cut(s) 115
BsuRI GGCC 1 cut(s) 136
BtsIMutI CAGTG 1 cut(s) 130
Cfr13I GGNCC 2 cut(s) 14, 134
CviJI RGCY 7 cut(s) 47, 68, 84, 98, 130, 136, 164
CviKI_1 RGCY 7 cut(s) 47, 68, 84, 98, 130, 136, 164
DdeI CTNAG 2 cut(s) 8, 165
DpnI GATC 1 cut(s) 117
DpnII GATC 1 cut(s) 115
EciI GGCGGA 1 cut(s) 78
Eco47I GGWCC 1 cut(s) 14
EcoO109I RGGNCCY 1 cut(s) 14
Fnu4HI GCNGC 4 cut(s) 45, 69, 148, 162
Fsp4HI GCNGC 4 cut(s) 45, 69, 148, 162
FspBI CTAG 2 cut(s) 90, 99
GluI GCNGC 4 cut(s) 45, 69, 148, 162
HaeIII GGCC 1 cut(s) 136
HapII CCGG 3 cut(s) 48, 76, 95
HinfI GANTC 1 cut(s) 4
HpaII CCGG 3 cut(s) 48, 76, 95
HpyAV CCTTC 2 cut(s) 74, 82
HpyCH4V TGCA 1 cut(s) 161
HpyF3I CTNAG 2 cut(s) 8, 165
Kzo9I GATC 1 cut(s) 115
LmnI GCTCC 1 cut(s) 65
LpnPI CCDG 6 cut(s) 31, 61, 70, 89, 108, 136
Lsp1109I GCAGC 3 cut(s) 55, 56, 134
MaeI CTAG 2 cut(s) 90, 99
MalI GATC 1 cut(s) 117
MboI GATC 1 cut(s) 115
MboII GAAGA 1 cut(s) 121
MflI RGATCY 1 cut(s) 115
MnlI CCTC 5 cut(s) 5, 23, 34, 99, 147
MspI CCGG 3 cut(s) 48, 76, 95
MspR9I CCNGG 1 cut(s) 77
NciI CCSGG 1 cut(s) 77
NdeII GATC 1 cut(s) 115
NlaIV GGNNCC 1 cut(s) 16
PfoI TCCNGGA 1 cut(s) 75
PkrI GCNGC 4 cut(s) 46, 70, 149, 163
PpuMI RGGWCCY 1 cut(s) 14
Psp5II RGGWCCY 1 cut(s) 14
PspN4I GGNNCC 1 cut(s) 16
PspPI GGNCC 2 cut(s) 14, 134
PspPPI RGGWCCY 1 cut(s) 14
PsuI RGATCY 1 cut(s) 115
SatI GCNGC 4 cut(s) 45, 69, 148, 162
Sau3AI GATC 1 cut(s) 115
Sau96I GGNCC 2 cut(s) 14, 134
ScrFI CCNGG 1 cut(s) 77
SetI ASST 3 cut(s) 70, 145, 166
SinI GGWCC 1 cut(s) 14
SsiI CCGC 1 cut(s) 63
SspMI CTAG 2 cut(s) 90, 99
StyD4I CCNGG 1 cut(s) 75
TscAI CASTG 1 cut(s) 130
TseI GCWGC 4 cut(s) 44, 68, 147, 161
TspRI CASTG 1 cut(s) 130
VpaK11BI GGWCC 1 cut(s) 14
XspI CTAG 2 cut(s) 90, 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.