Rroxscaffold_7G00214830

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0006967
Physical Location & Seq
Reverse (-)
65484568 .. 65485257
690 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00214830.1

Sequence Viewer

Length: 228 bp
ATGGGACCATCACTTAAGGGCGGCACCAATCCTCGGTCGTCGAAGGAACTTTGGGCTGTTGAGATGGATTCTTTGGCACAACAAGCGGTGGCAGAGGCTCAACTTCAGGCGGTGCGCGACTCGGTTGATGAAATTCGGGCCGCTCGAGCATTGATCCGCTCTGAAAATGTTGAGATTCATCTTAGTCAGCTAGCTAATCTAAGAACGGGCAGACAATCTATAGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.19

Weight (kDa)

5.75

Isoelectric Point (pI)

54.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 23
AccBSI CCGCTC 2 cut(s) 143, 159
AccII CGCG 1 cut(s) 117
AciI CCGC 5 cut(s) 21, 86, 110, 141, 157
AclWI GGATC 1 cut(s) 148
AcsI RAATTY 1 cut(s) 132
AcuI CTGAAG 1 cut(s) 89
AfiI CCNNNNNNNGG 1 cut(s) 33
AflII CTTAAG 1 cut(s) 14
AluBI AGCT 2 cut(s) 190, 194
AluI AGCT 2 cut(s) 190, 194
AlwI GGATC 1 cut(s) 148
Ama87I CYCGRG 1 cut(s) 144
AoxI GGCC 1 cut(s) 138
ApoI RAATTY 1 cut(s) 132
AspLEI GCGC 1 cut(s) 117
AspS9I GGNCC 2 cut(s) 5, 138
AsuNHI GCTAGC 1 cut(s) 190
AvaI CYCGRG 1 cut(s) 144
AvaII GGWCC 1 cut(s) 5
BanI GGYRCC 1 cut(s) 23
BccI CCATC 2 cut(s) 16, 58
BfaI CTAG 2 cut(s) 191, 226
BfmI CTRYAG 1 cut(s) 219
BfrI CTTAAG 1 cut(s) 14
BisI GCNGC 2 cut(s) 22, 141
BlsI GCNGC 2 cut(s) 23, 142
Bme18I GGWCC 1 cut(s) 5
BmeT110I CYCGRG 1 cut(s) 144
BmgT120I GGNCC 2 cut(s) 5, 138
BmiI GGNNCC 2 cut(s) 6, 25
BmtI GCTAGC 1 cut(s) 194
BsaJI CCNNGG 1 cut(s) 32
Bsc4I CCNNNNNNNGG 1 cut(s) 33
BseDI CCNNGG 1 cut(s) 32
BseLI CCNNNNNNNGG 1 cut(s) 33
Bsh1236I CGCG 1 cut(s) 117
Bsh1285I CGRYCG 1 cut(s) 38
BshFI GGCC 1 cut(s) 140
BshNI GGYRCC 1 cut(s) 23
BsiEI CGRYCG 1 cut(s) 38
BsiHKCI CYCGRG 1 cut(s) 144
BslFI GGGAC 1 cut(s) 18
BslI CCNNNNNNNGG 1 cut(s) 33
BsmFI GGGAC 1 cut(s) 18
BsnI GGCC 1 cut(s) 140
BsoBI CYCGRG 1 cut(s) 144
Bsp143I GATC 1 cut(s) 153
BspACI CCGC 5 cut(s) 21, 86, 110, 141, 157
BspANI GGCC 1 cut(s) 140
BspFNI CGCG 1 cut(s) 117
BspLI GGNNCC 2 cut(s) 6, 25
BspOI GCTAGC 1 cut(s) 194
BspPI GGATC 1 cut(s) 148
BspT107I GGYRCC 1 cut(s) 23
BspTI CTTAAG 1 cut(s) 14
BsrBI CCGCTC 2 cut(s) 143, 159
BssECI CCNNGG 1 cut(s) 32
BssMI GATC 1 cut(s) 153
BstAFI CTTAAG 1 cut(s) 14
BstC8I GCNNGC 1 cut(s) 192
BstDEI CTNAG 2 cut(s) 182, 200
BstFNI CGCG 1 cut(s) 117
BstHHI GCGC 1 cut(s) 117
BstKTI GATC 1 cut(s) 156
BstMBI GATC 1 cut(s) 153
BstMCI CGRYCG 1 cut(s) 38
BstMWI GCNNNNNNNGC 2 cut(s) 83, 146
BstSFI CTRYAG 1 cut(s) 219
BstUI CGCG 1 cut(s) 117
BsuRI GGCC 1 cut(s) 140
Cac8I GCNNGC 1 cut(s) 192
CfoI GCGC 1 cut(s) 117
Cfr13I GGNCC 2 cut(s) 5, 138
CviJI RGCY 5 cut(s) 56, 98, 140, 190, 194
CviKI_1 RGCY 5 cut(s) 56, 98, 140, 190, 194
DdeI CTNAG 2 cut(s) 182, 200
DpnI GATC 1 cut(s) 155
DpnII GATC 1 cut(s) 153
Eco47I GGWCC 1 cut(s) 5
Eco57I CTGAAG 1 cut(s) 89
Eco88I CYCGRG 1 cut(s) 144
FaiI YATR 1 cut(s) 221
FaqI GGGAC 1 cut(s) 18
Fnu4HI GCNGC 2 cut(s) 22, 141
Fsp4HI GCNGC 2 cut(s) 22, 141
FspBI CTAG 2 cut(s) 191, 226
GlaI GCGC 1 cut(s) 116
GluI GCNGC 2 cut(s) 22, 141
HaeIII GGCC 1 cut(s) 140
HhaI GCGC 1 cut(s) 117
Hin6I GCGC 1 cut(s) 115
HinP1I GCGC 1 cut(s) 115
HinfI GANTC 3 cut(s) 68, 119, 175
Hpy188I TCNGA 1 cut(s) 163
Hpy99I CGWCG 1 cut(s) 43
HpyAV CCTTC 1 cut(s) 37
HpyF10VI GCNNNNNNNGC 2 cut(s) 83, 146
HpyF3I CTNAG 2 cut(s) 182, 200
HspAI GCGC 1 cut(s) 115
Kzo9I GATC 1 cut(s) 153
LpnPI CCDG 1 cut(s) 92
MaeI CTAG 2 cut(s) 191, 226
MalI GATC 1 cut(s) 155
MbiI CCGCTC 2 cut(s) 143, 159
MboI GATC 1 cut(s) 153
MluCI AATT 1 cut(s) 132
MlyI GAGTC 1 cut(s) 113
MnlI CCTC 2 cut(s) 42, 88
MseI TTAA 1 cut(s) 15
MspCI CTTAAG 1 cut(s) 14
MvnI CGCG 1 cut(s) 117
MwoI GCNNNNNNNGC 2 cut(s) 83, 146
NdeII GATC 1 cut(s) 153
NheI GCTAGC 1 cut(s) 190
NlaIV GGNNCC 2 cut(s) 6, 25
PaeR7I CTCGAG 1 cut(s) 144
PcsI WCGNNNNNNNCGW 1 cut(s) 142
PfeI GAWTC 2 cut(s) 68, 175
PkrI GCNGC 2 cut(s) 23, 142
PleI GAGTC 1 cut(s) 113
PpsI GAGTC 1 cut(s) 113
PspN4I GGNNCC 2 cut(s) 6, 25
PspPI GGNCC 2 cut(s) 5, 138
PspXI VCTCGAGB 1 cut(s) 144
SaqAI TTAA 1 cut(s) 15
SatI GCNGC 2 cut(s) 22, 141
Sau3AI GATC 1 cut(s) 153
Sau96I GGNCC 2 cut(s) 5, 138
SchI GAGTC 1 cut(s) 113
SetI ASST 2 cut(s) 192, 196
SfcI CTRYAG 1 cut(s) 219
Sfr274I CTCGAG 1 cut(s) 144
SinI GGWCC 1 cut(s) 5
SlaI CTCGAG 1 cut(s) 144
SmlI CTYRAG 2 cut(s) 14, 144
SmoI CTYRAG 2 cut(s) 14, 144
Sse9I AATT 1 cut(s) 132
SsiI CCGC 5 cut(s) 21, 86, 110, 141, 157
SspMI CTAG 2 cut(s) 191, 226
TaqI TCGA 2 cut(s) 41, 145
TaqII GACCGA 1 cut(s) 24
TasI AATT 1 cut(s) 132
TauI GCSGC 2 cut(s) 24, 143
TfiI GAWTC 2 cut(s) 68, 175
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TspDTI ATGAA 2 cut(s) 144, 167
Vha464I CTTAAG 1 cut(s) 14
VpaK11BI GGWCC 1 cut(s) 5
XapI RAATTY 1 cut(s) 132
XhoI CTCGAG 1 cut(s) 144
XspI CTAG 2 cut(s) 191, 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.