Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004094.1

Orthogroup ID

OG0006967

Physical Location & Seq

Genomic Coordinates Reverse (-)

115166 .. 115561

Gene Structure 396 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004094.1_g000027.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 396 bp

atgggaccaaaacccaaaggaggcaataatggccagtcgtcgctagatttatcggcggcggagctagactatttggctcaccaggccatagcggaatctcagctacaagcgatgagtgagtcggtggctgaactccgtgcagaacaagcgagtatgccagcccagaacgcggagtttctctctcaaaacgccgagtttcgttcaatgttgttggacgagatgcgacagctacgggtaaccactttgcctcggcctgaaaccgatctagtgagctcggattcccttcgatttggtccttttccacctccggtaacatcttctcctcagattctggctacggggtctattccgattacgggaattccaattcggggttttgagcactttccaagatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

131

Amino Acids

14.19

Weight (kDa)

4.92

Isoelectric Point (pI)

57.12

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006967)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0451501 RchiOBHm_Chr3g0478591 RchiOBHm_Chr4g0415941 RchiOBHm_Chr5g0018841
rosa_laevigata	RLG00000004493 RLG00000013536
rosa_multiflora	Rmu_sc0000200.1_g000014 Rmu_sc0001488.1_g000024 Rmu_sc0002934.1_g000046 Rmu_sc0003822.1_g000025 Rmu_sc0004094.1_g000027 Rmu_sc0012521.1_g000009 Rmu_sc0031157.1_g000001
rosa_roxburghii	Rroxscaffold_1G00018770 Rroxscaffold_2G00080230 Rroxscaffold_2G00093080 Rroxscaffold_2G00108020 Rroxscaffold_2G00131900 Rroxscaffold_7G00190550 Rroxscaffold_7G00192620 Rroxscaffold_7G00194150 Rroxscaffold_7G00214830
rosa_rugosa	Rorug07G0096500
rosa_samantha	Rh4CG435100 Rh7AG275300 Rh7CG294100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	170
AciI	CCGC	4 cut(s)	56, 59, 92, 170
AcoI	YGGCCR	1 cut(s)	31
AcsI	RAATTY	1 cut(s)	360
AfiI	CCNNNNNNNGG	4 cut(s)	20, 169, 356, 371
AgsI	TTSAA	1 cut(s)	204
AjnI	CCWGG	1 cut(s)	81
AluBI	AGCT	4 cut(s)	64, 103, 229, 273
AluI	AGCT	4 cut(s)	64, 103, 229, 273
Alw21I	GWGCWC	2 cut(s)	275, 384
AlwNI	CAGNNNCTG	1 cut(s)	331
AoxI	GGCC	3 cut(s)	31, 84, 251
ApoI	RAATTY	1 cut(s)	360
AspS9I	GGNCC	2 cut(s)	5, 293
AsuHPI	GGTGA	1 cut(s)	71
AvaII	GGWCC	2 cut(s)	5, 293
BalI	TGGCCA	1 cut(s)	33
BanII	GRGCYC	1 cut(s)	275
Bbv12I	GWGCWC	2 cut(s)	275, 384
BciT130I	CCWGG	1 cut(s)	83
BfaI	CTAG	3 cut(s)	44, 65, 266
BisI	GCNGC	1 cut(s)	57
BlsI	GCNGC	1 cut(s)	58
Bme1390I	CCNGG	1 cut(s)	83
Bme18I	GGWCC	2 cut(s)	5, 293
BmgT120I	GGNCC	2 cut(s)	5, 293
BmiI	GGNNCC	1 cut(s)	6
BmrFI	CCNGG	1 cut(s)	83
BmsI	GCATC	1 cut(s)	210
BplI	GAGNNNNNCTC	2 cut(s)	164, 196
BsaJI	CCNNGG	1 cut(s)	248
BsaWI	WCCGGW	1 cut(s)	307
BsaXI	ACNNNNNCTCC	2 cut(s)	304, 334
Bsc4I	CCNNNNNNNGG	4 cut(s)	20, 169, 356, 371
Bse1I	ACTGG	1 cut(s)	34
BseBI	CCWGG	1 cut(s)	83
BseDI	CCNNGG	1 cut(s)	248
BseLI	CCNNNNNNNGG	4 cut(s)	20, 169, 356, 371
BseMII	CTCAG	2 cut(s)	113, 338
BseNI	ACTGG	1 cut(s)	34
BseRI	GAGGAG	1 cut(s)	312
BsgI	GTGCAG	1 cut(s)	159
Bsh1236I	CGCG	1 cut(s)	170
BshFI	GGCC	3 cut(s)	33, 86, 253
BsiHKAI	GWGCWC	2 cut(s)	275, 384
BsiSI	CCGG	1 cut(s)	308
BslFI	GGGAC	1 cut(s)	18
BslI	CCNNNNNNNGG	4 cut(s)	20, 169, 356, 371
BsmFI	GGGAC	1 cut(s)	18
BsnI	GGCC	3 cut(s)	33, 86, 253
Bsp1286I	GDGCHC	2 cut(s)	275, 384
Bsp143I	GATC	1 cut(s)	262
BspACI	CCGC	4 cut(s)	56, 59, 92, 170
BspANI	GGCC	3 cut(s)	33, 86, 253
BspCNI	CTCAG	2 cut(s)	112, 337
BspFNI	CGCG	1 cut(s)	170
BspLI	GGNNCC	1 cut(s)	6
BsrI	ACTGG	1 cut(s)	34
BssECI	CCNNGG	1 cut(s)	248
BssMI	GATC	1 cut(s)	262
Bst2UI	CCWGG	1 cut(s)	83
BstC8I	GCNNGC	1 cut(s)	159
BstDEI	CTNAG	2 cut(s)	99, 324
BstEII	GGTNACC	1 cut(s)	235
BstFNI	CGCG	1 cut(s)	170
BstKTI	GATC	1 cut(s)	265
BstMBI	GATC	1 cut(s)	262
BstMWI	GCNNNNNNNGC	4 cut(s)	30, 83, 146, 167
BstNI	CCWGG	1 cut(s)	83
BstPI	GGTNACC	1 cut(s)	235
BstSCI	CCNGG	1 cut(s)	81
BstUI	CGCG	1 cut(s)	170
BsuRI	GGCC	3 cut(s)	33, 86, 253
BtgZI	GCGATG	1 cut(s)	125
Cac8I	GCNNGC	1 cut(s)	159
CaiI	CAGNNNCTG	1 cut(s)	331
Cfr13I	GGNCC	2 cut(s)	5, 293
DdeI	CTNAG	2 cut(s)	99, 324
DpnI	GATC	1 cut(s)	264
DpnII	GATC	1 cut(s)	262
EaeI	YGGCCR	1 cut(s)	31
EciI	GGCGGA	1 cut(s)	74
Ecl136II	GAGCTC	1 cut(s)	273
Eco24I	GRGCYC	1 cut(s)	275
Eco47I	GGWCC	2 cut(s)	5, 293
Eco53kI	GAGCTC	1 cut(s)	273
Eco91I	GGTNACC	1 cut(s)	235
EcoICRI	GAGCTC	1 cut(s)	273
EcoO65I	GGTNACC	1 cut(s)	235
EcoRI	GAATTC	1 cut(s)	360
EcoRII	CCWGG	1 cut(s)	81
EcoT38I	GRGCYC	1 cut(s)	275
FaiI	YATR	2 cut(s)	89, 155
FaqI	GGGAC	1 cut(s)	18
Fnu4HI	GCNGC	1 cut(s)	57
FriOI	GRGCYC	1 cut(s)	275
Fsp4HI	GCNGC	1 cut(s)	57
FspBI	CTAG	3 cut(s)	44, 65, 266
GluI	GCNGC	1 cut(s)	57
HaeIII	GGCC	3 cut(s)	33, 86, 253
HapII	CCGG	1 cut(s)	308
HinfI	GANTC	4 cut(s)	95, 119, 278, 328
HpaII	CCGG	1 cut(s)	308
HphI	GGTGA	1 cut(s)	71
Hpy188I	TCNGA	3 cut(s)	277, 327, 351
Hpy99I	CGWCG	1 cut(s)	43
HpyAV	CCTTC	1 cut(s)	293
HpyCH4V	TGCA	1 cut(s)	140
HpyF10VI	GCNNNNNNNGC	4 cut(s)	30, 83, 146, 167
HpyF3I	CTNAG	2 cut(s)	99, 324
Kzo9I	GATC	1 cut(s)	262
LmnI	GCTCC	1 cut(s)	61
LpnPI	CCDG	8 cut(s)	47, 68, 95, 171, 176, 267, 317, 321
LweI	GCATC	1 cut(s)	210
MaeI	CTAG	3 cut(s)	44, 65, 266
MaeIII	GTNAC	2 cut(s)	235, 310
MalI	GATC	1 cut(s)	264
MboI	GATC	1 cut(s)	262
MboII	GAAGA	1 cut(s)	309
MhlI	GDGCHC	2 cut(s)	275, 384
MlsI	TGGCCA	1 cut(s)	33
MluCI	AATT	2 cut(s)	360, 366
MluNI	TGGCCA	1 cut(s)	33
MlyI	GAGTC	1 cut(s)	128
MmeI	TCCRAC	1 cut(s)	192
MnlI	CCTC	4 cut(s)	14, 258, 315, 333
Mox20I	TGGCCA	1 cut(s)	33
MscI	TGGCCA	1 cut(s)	33
Msp20I	TGGCCA	1 cut(s)	33
MspI	CCGG	1 cut(s)	308
MspR9I	CCNGG	1 cut(s)	83
MvaI	CCWGG	1 cut(s)	83
MvnI	CGCG	1 cut(s)	170
MwoI	GCNNNNNNNGC	4 cut(s)	30, 83, 146, 167
NdeII	GATC	1 cut(s)	262
NlaIV	GGNNCC	1 cut(s)	6
NmeAIII	GCCGAG	2 cut(s)	217, 229
PfeI	GAWTC	3 cut(s)	95, 278, 328
PkrI	GCNGC	1 cut(s)	58
PleI	GAGTC	1 cut(s)	127
PpsI	GAGTC	1 cut(s)	127
Psp124BI	GAGCTC	1 cut(s)	275
Psp6I	CCWGG	1 cut(s)	81
PspEI	GGTNACC	1 cut(s)	235
PspGI	CCWGG	1 cut(s)	81
PspN4I	GGNNCC	1 cut(s)	6
PspPI	GGNCC	2 cut(s)	5, 293
PstNI	CAGNNNCTG	1 cut(s)	331
SacI	GAGCTC	1 cut(s)	275
SatI	GCNGC	1 cut(s)	57
Sau3AI	GATC	1 cut(s)	262
Sau96I	GGNCC	2 cut(s)	5, 293
SchI	GAGTC	1 cut(s)	128
ScrFI	CCNGG	1 cut(s)	83
SduI	GDGCHC	2 cut(s)	275, 384
SetI	ASST	5 cut(s)	66, 105, 231, 275, 307
SfaNI	GCATC	1 cut(s)	210
SinI	GGWCC	2 cut(s)	5, 293
Sse9I	AATT	2 cut(s)	360, 366
SsiI	CCGC	4 cut(s)	56, 59, 92, 170
SspMI	CTAG	3 cut(s)	44, 65, 266
SstI	GAGCTC	1 cut(s)	275
StyD4I	CCNGG	1 cut(s)	81
TaqI	TCGA	1 cut(s)	286
TasI	AATT	2 cut(s)	360, 366
TauI	GCSGC	1 cut(s)	59
TfiI	GAWTC	3 cut(s)	95, 278, 328
TspGWI	ACGGA	1 cut(s)	125
VpaK11BI	GGWCC	2 cut(s)	5, 293
XapI	RAATTY	1 cut(s)	360
XspI	CTAG	3 cut(s)	44, 65, 266

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.