Rorug07G0096500

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Forward (+)
7579092 .. 7579603
512 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0096500.1

Sequence Viewer

Length: 204 bp
ATGCCGTCAAGAATGTCTCCGAATATTGCACAAGATAATGGGTATATAGTGAAGAGCCTTGTGCCCATTGTGATGTTGGCCGGGTATATAGTTCCTGAGTGGGTGGAGGAAAAGCCAACGCTATCTGACATAAAACAGATATATGGTTCTGCTACAGCCTTTCCAGTTTCCACCCACAGCACTAATCTTACCTCTAAAACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.32

Weight (kDa)

6.53

Isoelectric Point (pI)

48.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 78
Alw26I GTCTC 1 cut(s) 21
AoxI GGCC 1 cut(s) 78
AsuC2I CCSGG 1 cut(s) 82
BaeGI GKGCMC 1 cut(s) 66
BcnI CCSGG 1 cut(s) 82
BcoDI GTCTC 1 cut(s) 21
BfmI CTRYAG 1 cut(s) 153
Bme1390I CCNGG 1 cut(s) 82
BmrFI CCNGG 1 cut(s) 82
BpuMI CCSGG 1 cut(s) 82
Bse1I ACTGG 1 cut(s) 164
BseMII CTCAG 1 cut(s) 87
BseNI ACTGG 1 cut(s) 164
BseSI GKGCMC 1 cut(s) 66
BshFI GGCC 1 cut(s) 80
BsiSI CCGG 1 cut(s) 81
BsmAI GTCTC 1 cut(s) 21
BsnI GGCC 1 cut(s) 80
Bsp1286I GDGCHC 1 cut(s) 66
BspANI GGCC 1 cut(s) 80
BspCNI CTCAG 1 cut(s) 88
BspQI GCTCTTC 1 cut(s) 47
BsrI ACTGG 1 cut(s) 164
Bst6I CTCTTC 1 cut(s) 47
BstDEI CTNAG 1 cut(s) 96
BstMAI GTCTC 1 cut(s) 21
BstSCI CCNGG 1 cut(s) 80
BstSFI CTRYAG 1 cut(s) 153
BstSLI GKGCMC 1 cut(s) 66
BsuRI GGCC 1 cut(s) 80
CviJI RGCY 4 cut(s) 57, 80, 115, 158
CviKI_1 RGCY 4 cut(s) 57, 80, 115, 158
DdeI CTNAG 1 cut(s) 96
EaeI YGGCCR 1 cut(s) 78
Eam1104I CTCTTC 1 cut(s) 47
EarI CTCTTC 1 cut(s) 47
FaiI YATR 7 cut(s) 45, 47, 87, 89, 131, 142, 144
HaeIII GGCC 1 cut(s) 80
HapII CCGG 1 cut(s) 81
HpaII CCGG 1 cut(s) 81
Hpy188I TCNGA 2 cut(s) 21, 127
Hpy188III TCNNGA 2 cut(s) 9, 95
HpyCH4V TGCA 1 cut(s) 29
HpyF3I CTNAG 1 cut(s) 96
LguI GCTCTTC 1 cut(s) 47
LpnPI CCDG 3 cut(s) 94, 108, 177
MboII GAAGA 1 cut(s) 64
MhlI GDGCHC 1 cut(s) 66
MnlI CCTC 2 cut(s) 100, 202
MslI CAYNNNNRTG 1 cut(s) 71
MspI CCGG 1 cut(s) 81
MspR9I CCNGG 1 cut(s) 82
NciI CCSGG 1 cut(s) 82
PciSI GCTCTTC 1 cut(s) 47
RseI CAYNNNNRTG 1 cut(s) 71
SapI GCTCTTC 1 cut(s) 47
ScrFI CCNGG 1 cut(s) 82
SduI GDGCHC 1 cut(s) 66
SetI ASST 2 cut(s) 194, 203
SfcI CTRYAG 1 cut(s) 153
SgeI CNNG 7 cut(s) 21, 44, 71, 93, 94, 107, 176
SmiMI CAYNNNNRTG 1 cut(s) 71
SspI AATATT 1 cut(s) 25
StyD4I CCNGG 1 cut(s) 80
XcmI CCANNNNNNNNNTGG 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.